<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing with OASIS Tables v3.0 20080202//EN" "journalpub-oasis3.dtd">
<article xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:oasis="http://docs.oasis-open.org/ns/oasis-exchange/table" xml:lang="en" dtd-version="3.0">
  <front>
    <journal-meta><journal-id journal-id-type="publisher">ACP</journal-id><journal-title-group>
    <journal-title>Atmospheric Chemistry and Physics</journal-title>
    <abbrev-journal-title abbrev-type="publisher">ACP</abbrev-journal-title><abbrev-journal-title abbrev-type="nlm-ta">Atmos. Chem. Phys.</abbrev-journal-title>
  </journal-title-group><issn pub-type="epub">1680-7324</issn><publisher>
    <publisher-name>Copernicus Publications</publisher-name>
    <publisher-loc>Göttingen, Germany</publisher-loc>
  </publisher></journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.5194/acp-20-5609-2020</article-id><title-group><article-title>High levels of primary biogenic organic aerosols are driven by only a few
plant-associated microbial taxa</article-title><alt-title>High levels of primary biogenic organic aerosols</alt-title>
      </title-group><?xmltex \runningtitle{High levels of primary biogenic organic aerosols}?><?xmltex \runningauthor{A. Samak\'{e} et al.}?>
      <contrib-group>
        <contrib contrib-type="author" corresp="yes" rid="aff1">
          <name><surname>Samaké</surname><given-names>Abdoulaye</given-names></name>
          <email>abdoulaye.samake2@univ-grenoble-alpes.fr</email>
        </contrib>
        <contrib contrib-type="author" corresp="no" rid="aff2">
          <name><surname>Bonin</surname><given-names>Aurélie</given-names></name>
          
        </contrib>
        <contrib contrib-type="author" corresp="no" rid="aff1">
          <name><surname>Jaffrezo</surname><given-names>Jean-Luc</given-names></name>
          
        </contrib>
        <contrib contrib-type="author" corresp="no" rid="aff2">
          <name><surname>Taberlet</surname><given-names>Pierre</given-names></name>
          
        </contrib>
        <contrib contrib-type="author" corresp="no" rid="aff1">
          <name><surname>Weber</surname><given-names>Samuël</given-names></name>
          
        <ext-link>https://orcid.org/0000-0002-7379-7853</ext-link></contrib>
        <contrib contrib-type="author" corresp="no" rid="aff1">
          <name><surname>Uzu</surname><given-names>Gaëlle</given-names></name>
          
        <ext-link>https://orcid.org/0000-0002-7720-0233</ext-link></contrib>
        <contrib contrib-type="author" corresp="no" rid="aff1">
          <name><surname>Jacob</surname><given-names>Véronique</given-names></name>
          
        </contrib>
        <contrib contrib-type="author" corresp="no" rid="aff3">
          <name><surname>Conil</surname><given-names>Sébastien</given-names></name>
          
        </contrib>
        <contrib contrib-type="author" corresp="no" rid="aff1">
          <name><surname>Martins</surname><given-names>Jean M. F.</given-names></name>
          
        </contrib>
        <aff id="aff1"><label>1</label><institution>Université Grenoble Alpes, CNRS, IRD, INP-G, IGE (UMR 5001),
Grenoble, 38000, France</institution>
        </aff>
        <aff id="aff2"><label>2</label><institution>Université Grenoble Alpes, CNRS, LECA (UMR 5553), BP 53,
Grenoble, 38041, France</institution>
        </aff>
        <aff id="aff3"><label>3</label><institution>ANDRA DRD/OPE Observatoire Pérenne de l'Environnement, 55290 Bure,
France</institution>
        </aff>
      </contrib-group>
      <author-notes><corresp id="corr1">Abdoulaye Samaké (abdoulaye.samake2@univ-grenoble-alpes.fr) and Jean
Martins (jean.martins@univ-grenoble-alpes.fr)</corresp></author-notes><pub-date><day>13</day><month>May</month><year>2020</year></pub-date>
      
      <volume>20</volume>
      <issue>9</issue>
      <fpage>5609</fpage><lpage>5628</lpage>
      <history>
        <date date-type="received"><day>15</day><month>December</month><year>2019</year></date>
           <date date-type="rev-request"><day>9</day><month>January</month><year>2020</year></date>
           <date date-type="rev-recd"><day>11</day><month>March</month><year>2020</year></date>
           <date date-type="accepted"><day>14</day><month>April</month><year>2020</year></date>
      </history>
      <permissions>
        <copyright-statement>Copyright: © 2020 Abdoulaye Samaké et al.</copyright-statement>
        <copyright-year>2020</copyright-year>
      <license license-type="open-access"><license-p>This work is licensed under the Creative Commons Attribution 4.0 International License. To view a copy of this licence, visit <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">https://creativecommons.org/licenses/by/4.0/</ext-link></license-p></license></permissions><self-uri xlink:href="https://acp.copernicus.org/articles/20/5609/2020/acp-20-5609-2020.html">This article is available from https://acp.copernicus.org/articles/20/5609/2020/acp-20-5609-2020.html</self-uri><self-uri xlink:href="https://acp.copernicus.org/articles/20/5609/2020/acp-20-5609-2020.pdf">The full text article is available as a PDF file from https://acp.copernicus.org/articles/20/5609/2020/acp-20-5609-2020.pdf</self-uri>
      <abstract><title>Abstract</title>
    <p id="d1e167">Primary biogenic organic aerosols (PBOAs) represent a
major fraction of coarse organic matter (OM) in air. Despite their
implication in many atmospheric processes and human health problems, we
surprisingly know little about PBOA characteristics (i.e., composition,
dominant sources, and contribution to airborne particles). In addition,
specific primary sugar compounds (SCs) are generally used as markers of PBOAs
associated with bacteria and fungi, but our knowledge of microbial
communities associated with atmospheric particulate matter (PM) remains
incomplete. This work aimed at providing a comprehensive understanding of
the microbial fingerprints associated with SCs in PM<inline-formula><mml:math id="M1" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> (particles
smaller than 10 <inline-formula><mml:math id="M2" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>m) and their main sources in the surrounding
environment (soils and vegetation). An intensive study was conducted on
PM<inline-formula><mml:math id="M3" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> collected at a rural background site located in an agricultural area
in France. We combined high-throughput sequencing of bacteria and fungi with
detailed physicochemical characterizations of PM<inline-formula><mml:math id="M4" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula>, soil, and plant
samples and monitored meteorological and agricultural activities throughout
the sampling period. Results show that in summer SCs in PM<inline-formula><mml:math id="M5" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> are a
major contributor of OM in air, representing 0.8 % to 13.5 % of OM mass. SC
concentrations are clearly determined by the abundance of only a few
specific airborne fungal and bacterial taxa. The temporal fluctuations in the
abundance of only four predominant fungal genera, namely <italic>Cladosporium</italic>, <italic>Alternaria</italic>,
<italic>Sporobolomyces</italic>, and <italic>Dioszegia</italic>, reflect the
temporal dynamics in SC concentrations. Among bacterial taxa, the abundance
of only <italic>Massilia</italic>, <italic>Pseudomonas</italic>, <italic>Frigoribacterium</italic>, and <italic>Sphingomonas</italic>
is positively correlated with SC species. These
microbes
are significantly enhanced in leaf over soil samples. Interestingly, the
overall community structure of bacteria and fungi are similar within
PM<inline-formula><mml:math id="M6" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> and leaf samples and significantly distinct between PM<inline-formula><mml:math id="M7" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> and
soil samples, indicating that surrounding vegetation is the major source of
SC-associated microbial taxa in PM<inline-formula><mml:math id="M8" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> in this rural area of France.</p>
  </abstract>
    </article-meta>
  </front>
<body>
      

<sec id="Ch1.S1" sec-type="intro">
  <label>1</label><title>Introduction</title>
      <p id="d1e276">Airborne particulate matter (PM) is the subject of high scientific and
political interest mainly because of its important effects on climate and
public health (Boucher et
al., 2013; Fröhlich-Nowoisky et al., 2016; Fuzzi et al., 2006). Numerous
epidemiological studies have significantly related both acute and chronic
exposures to ambient PM with respiratory impairments, heart diseases,
asthma, and lung cancer, as well as increased risk of mortality
(Kelly and Fussell, 2015; Lecours et al., 2017; Pope and Dockery, 2006).
PM can also affect directly or indirectly the climate by absorbing and/or
diffusing both the incoming and outgoing solar radiation
(Boucher et al., 2013;
Fröhlich-Nowoisky et al., 2016). These effects are modulated by highly
variable physical characteristics (e.g., size, specific surface,
concentrations) and the complex chemical composition of PM
(Fröhlich-Nowoisky
et al., 2016; Fuzzi et al., 2015). PM consists of a complex mixture of
inorganic trace elements and carbonaceous matter (organic carbon and
elemental carbon), with organic<?pagebreak page5610?> matter (OM) generally being the major but
poorly characterized constituent of PM (Boucher et
al., 2013; Bozzetti et al., 2016; Fortenberry et al., 2018). A quantitative understanding of OM
sources is critically important to develop efficient guidelines for both air-quality control and abatement strategies. So far, considerable efforts have
been undertaken to investigate OM associated with anthropogenic and
secondary sources, but much less is known about emissions from primary
biogenic sources
(Bozzetti et
al., 2016; China et al., 2018; Yan et al., 2019).</p>
      <p id="d1e279">Primary biogenic organic aerosols (PBOAs) are a subset of organic PM that
are directly emitted by processes involving the biosphere
(Boucher et al., 2013; Elbert et al., 2007). PBOAs
typically  refer to biologically derived materials, notably including living
organisms (e.g., bacteria, fungal spores, Protozoa, viruses), nonliving
biomass (e.g., microbial fragments), and other types of biological materials
like pollen or plant debris (Amato et al., 2017; Elbert et al., 2007;
Fröhlich-Nowoisky et al., 2016). PBOAs are gaining increasing attention
notably because of their ability to affect human health by causing
infectious, toxic, and hypersensitivity diseases (Fröhlich-Nowoisky et
al., 2016; Huffman et al., 2019). For instance, PBOA components, especially
fungal spores and bacterial cells, have recently been shown to cause
significant oxidative potential (Samaké et al., 2017). However, to date,
the precise role of PBOA components and interplay regarding mechanisms of
diseases are remarkably misunderstood
(Coz et
al., 2010; Hill et al., 2017). Specific PBOA components can also participate
in many relevant atmospheric processes like cloud condensation and ice
nucleation, thereby directly or indirectly affecting the Earth's
hydrological cycle and radiative balance
(Boucher et al.,
2013; Fröhlich-Nowoisky et al., 2016; Hill et al., 2017). These diverse
impacts are effective at a regional scale due to the transport of PBOAs
(Dommergue et al., 2019; Yu et al.,
2016). Moreover, PBOAs are a major component of OM found in particles less
than 10 <inline-formula><mml:math id="M9" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>m in aerodynamic diameter (PM<inline-formula><mml:math id="M10" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula>)
(Bozzetti
et al., 2016; Coz et al., 2010; Samaké et al., 2019b). For instance,
Bozzetti et al. (2016) have shown that PBOAs equal the
contribution of secondary organic aerosols (SOAs) to OM in PM<inline-formula><mml:math id="M11" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula>
collected at a rural background site in Switzerland during both the summer
and winter periods. However, current estimates of global terrestrial PBOA
emissions are very uncertain and range between 50 and 1000 Tg yr<inline-formula><mml:math id="M12" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>
(Boucher et al.,
2013; Coz et al., 2010; Elbert et al., 2007), underlining the critical gap
in the understanding of this significant OM fraction.</p>
      <p id="d1e320">The recent application of fluorescent technics, such as the ultraviolet
aerodynamic particle sizer, the wideband integrated bioaerosol sensor
(Bozzetti et al., 2016; Gosselin et
al., 2016; Huffman and Santarpia, 2017; Huffman et al., 2019), and scanning
electron microscopy (Coz et al.,
2010), has provided very insightful information on the abundance of size-segregated
ambient PBOAs. Atmospheric sources of PBOAs are numerous and
include agricultural activities, leaf abrasion, and soil resuspension
(Coz
et al., 2010; Medeiros et al., 2006; Pietrogrande et al., 2014). To date,
the detailed constituents of PBOAs, their predominant sources, and their
atmospheric emission processes, as well as their contributions to total
airborne particles, remain poorly documented and quantified
(Bozzetti et
al., 2016; Coz et al., 2010; Elbert et al., 2007). Such information would be
important for investigating the properties and atmospheric impacts of PBOAs,
as well as for a future optimization of source-resolved chemical transport
models (CTMs), which are still generally unable to accurately simulate
important OM fractions
(Ciarelli
et al., 2016; Heald et al., 2011; Kang et al., 2018).</p>
      <p id="d1e323">Primary sugar compounds (SCs, defined as sugar alcohols and saccharides) are
ubiquitous water-soluble compounds found in atmospheric PM
(Gosselin
et al., 2016; Medeiros et al., 2006; Pietrogrande et al., 2014; Jia et al.,
2010b). SC species are emitted from biologically derived sources (Medeiros
et al., 2006; Verma et al., 2018) and have sometimes been detected in
aerosols taken from air masses influenced by smoke from biomass burning (Fu
et al., 2012; Yang et al., 2012). However, recent studies conducted at
several sites across France revealed a weak correlation between daily
concentrations of SC and levoglucosan in PM<inline-formula><mml:math id="M13" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">2.5</mml:mn></mml:msub></mml:math></inline-formula> and PM<inline-formula><mml:math id="M14" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> collected
throughout the year (Golly et al., 2018; Samaké et al., 2019a). This
suggests that the open burning of biomass is not a significant source of SCs in
the environments studied here. In this context, specific SC species are
still extensively viewed as powerful markers for tracking sources and
estimating PBOA contributions to OM mass
(Bauer
et al., 2008; Gosselin et al., 2016; Jia et al., 2010b; Medeiros et al.,
2006). For example, glucose is the most common monosaccharide in vascular
plants, and it has been predominantly used as an indicator of plant material
(such as pollen or plant debris) from several areas around the world
(Jia
et al., 2010b; Medeiros et al., 2006; Pietrogrande et al., 2014; Verma et
al., 2018). Trehalose (a.k.a. mycose) is a common metabolite of various
microorganisms, serving as an osmoprotectant accumulating in a cell's cytosol
during harsh conditions (e.g., dehydration and heat)
(Bougouffa et al., 2014). It has been proposed
as a generic indicator of soil-borne microbiota
(Jia
et al., 2010b; Medeiros et al., 2006; Pietrogrande et al., 2014; Verma et
al., 2018). Similarly, mannitol and arabitol are two very common sugar
alcohols (also called polyols), serving as storage and transport solutes in
fungi (Gosselin et
al., 2016; Medeiros et al., 2006; Verma et al., 2018). Their atmospheric
concentration levels have frequently been used to investigate fungal spore
contributions to PBOA mass in different environments (urban, rural, costal,
and polar) around the world
(Barbaro
et al., 2015; Gosselin et al., 2016; Jia et al., 2010b; Verma et al., 2018;
Weber et al., 2018).</p>
      <p id="d1e345">Despite the relatively vast literature using the atmospheric concentration
levels of SCs as potential suitable markers of PBOAs associated with bacteria
and fungi, our understanding of associated airborne microbial communities
(i.e., diversity and community composition) remains poor. This is<?pagebreak page5611?> due in
particular to the lack of high-resolution (i.e., daily) data sets
characterizing how well the variability of these microbial communities may
be related to that of primary sugar species. Such information is of
paramount importance to better understand the dominant atmospheric sources
of SCs (and then PBOAs), as well as their relevant effective environmental
drivers, which are still poorly documented (Bozzetti et
al., 2016).</p>
      <p id="d1e348">Our recent works discussed the size distribution features and the
spatial and temporal variability in atmospheric particulate SC
concentrations in France
(Golly
et al., 2018; Samaké et al., 2019a, b). As a continuation, in this
study we present the first daily temporal-concurrent characterization of
ambient SC species concentrations and both bacterial and fungal community
compositions for PM<inline-formula><mml:math id="M15" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> collected at a rural background site located in
an intensive agricultural area. The aim of this study was to use a DNA
metabarcoding approach (Taberlet et al., 2018) to
investigate PM<inline-formula><mml:math id="M16" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula>-associated microbial communities, which can help
answer the following research questions. (i) What are the microbial
community structures associated with PM<inline-formula><mml:math id="M17" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula>? (ii) Is the temporal
dynamics of SC concentrations related to changes in the airborne microbial
community composition? (iii) What are the predominant sources of
SC-associated microbial communities at a continental rural field site? Since
soil and vegetation are currently believed to be the dominant sources of
airborne microorganisms in most continental areas
(Bowers
et al., 2011; Jia et al., 2010a; Rathnayake et al., 2016), our study focused
on these two potential sources.</p>
</sec>
<sec id="Ch1.S2">
  <label>2</label><title>Material and methods</title>
<sec id="Ch1.S2.SS1">
  <label>2.1</label><title>Site description</title>
      <p id="d1e393">The Observatoire Pérenne de l'Environnement (OPE) is a continental rural
background observatory located about 230 km east of Paris at an altitude
of 392 m (Fig. 1). This French critical zone observatory (CZO) is part of a
long-term multidisciplinary project monitoring the state of environmental
variables, including among others fluxes, abiotic and biotic variables, and
their functions and dynamics (<uri>http://ope.andra.fr/index.php?lang=en</uri>, last
access: 10 December  2019). It is largely impacted by agricultural
activities. It is also characterized by a low population density (less than
22 per square kilometer within an area of 900 km<inline-formula><mml:math id="M18" display="inline"><mml:msup><mml:mi/><mml:mn mathvariant="normal">2</mml:mn></mml:msup></mml:math></inline-formula>) with no
industrial activities or surrounding major transport roads. The air
monitoring site itself lies in a “reference sector” of 240 km<inline-formula><mml:math id="M19" display="inline"><mml:msup><mml:mi/><mml:mn mathvariant="normal">2</mml:mn></mml:msup></mml:math></inline-formula> in the middle of a
field crop area (tens of kilometers in all directions). This reference
sector is composed of vast farmlands interspersed with wooded areas. The
area is further defined by a homogeneous soil type with a predominantly
superficial clay–limestone composition. The daily agricultural practices and
meteorological data (including wind speed and direction, temperature,
rainfall level, and relative humidity) within the reference sector are
recorded and made available by ANDRA (Agence nationale pour la gestion des
déchets radioactifs). The agricultural fields of the area are generally
submitted to a 3-year crop-rotation system. The major crops during the
campaign period were pea and oilseed rape.</p>

      <?xmltex \floatpos{t}?><fig id="Ch1.F1" specific-use="star"><?xmltex \currentcnt{1}?><label>Figure 1</label><caption><p id="d1e419">Overview of the sampling area at the OPE site (France). <bold>(a)</bold>  Location of sampling units and <bold>(b)</bold> wind conditions (speed and direction)
during the field-sampling campaign period.</p></caption>
          <?xmltex \igopts{width=497.923228pt}?><graphic xlink:href="https://acp.copernicus.org/articles/20/5609/2020/acp-20-5609-2020-f01.png"/>

        </fig>

</sec>
<sec id="Ch1.S2.SS2">
  <label>2.2</label><title>Sample collection</title>
      <p id="d1e442">An intensive field campaign was conducted at this site for the sake of the
present study. The aerosol sampling campaign period lasted from 12 June
to 21 August  2017, covering the summer period in France.
During this period, ambient PM<inline-formula><mml:math id="M20" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> was collected daily
(from 09:00 UTC to 09:00 UTC the next day)
onto prebaked quartz fiber filters (Pall Tissuquartz
2500QAT-UP, <inline-formula><mml:math id="M21" display="inline"><mml:mrow><mml:mi mathvariant="italic">Ø</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">150</mml:mn></mml:mrow></mml:math></inline-formula> mm) using high-volume samplers (Aerosol
Sampler DHA-80, DIGITEL; 24 h at 30 m<inline-formula><mml:math id="M22" display="inline"><mml:msup><mml:mi/><mml:mn mathvariant="normal">3</mml:mn></mml:msup></mml:math></inline-formula> h<inline-formula><mml:math id="M23" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>). After collection, all
filter samples were wrapped in aluminum foil, sealed in zipper plastic
bags, and stored at <inline-formula><mml:math id="M24" display="inline"><mml:mrow><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">4</mml:mn></mml:mrow></mml:math></inline-formula> <inline-formula><mml:math id="M25" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C until further analysis. More details on
the preparation, storage, and handling of these filter samples can be found
in Samaké
et al. (2019b). A total of 69 samples and 6 field blanks were collected.</p>
      <p id="d1e507">Surface soil samples (0–5 cm depth, <inline-formula><mml:math id="M26" display="inline"><mml:mn mathvariant="normal">15</mml:mn></mml:math></inline-formula> cm<inline-formula><mml:math id="M27" display="inline"><mml:mrow><mml:mo>×</mml:mo><mml:mn mathvariant="normal">15</mml:mn></mml:mrow></mml:math></inline-formula> cm area) were simultaneously
collected from two fields within the pea and oilseed rape growing areas.
The fields are located in the immediate vicinity of the
PM<inline-formula><mml:math id="M28" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> sampler and under the prevailing wind directions (Fig. 1). To
represent as closely as possible the local soil microbial communities, we
randomly collected five subsamples (about 100 g per sampling unit) within
each parcel and pooled them. Topsoil sampling took place on a weekly basis
during the campaign period. After collection and homogenization, 15 g of each
subsample was stored in airtight containers (sterile bottles, Schott, GL45,
100 mL) containing the same weight of sterile silica gel (around 15 g). Such
a soil desiccation method is a straightforward approach to prevent any
microbial growth and change in community over time at room temperature
(Taberlet et al., 2018). A total of eight topsoil
samples were collected for each parcel.</p>
      <p id="d1e536">Finally, leaf samples were collected from the major types of vegetation
within the reference sector. These include leaves of oilseed rape, pea, oak,
maple, beech, and herbs (Fig. 1). A total of eight leaf samples were
analyzed. These samples were also stored in airtight containers (sterile
bottles, Schott, GL45, 100 mL) containing 15 g of silica gel. It should be
noted that leaf samples were collected only once, 4 weeks after the end
of PM and soil sampling, while the major crops were still on site.</p>
</sec>
<sec id="Ch1.S2.SS3">
  <label>2.3</label><title>Chemical analyses</title>
      <p id="d1e547">Daily PM<inline-formula><mml:math id="M29" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> samples were analyzed for various chemical species using
subsampled fractions of the collection filters and a large array of
analytical methods. Detailed information<?pagebreak page5612?> on all the chemical-analysis
procedures has been reported previously
(Golly
et al., 2018; Samaké et al., 2019b; Waked et al., 2014). Briefly, SCs
(i.e., polyols and saccharides) and water-soluble ions (including <inline-formula><mml:math id="M30" display="inline"><mml:mrow class="chem"><mml:msup><mml:mi mathvariant="normal">Ca</mml:mi><mml:mrow><mml:mn mathvariant="normal">2</mml:mn><mml:mo>+</mml:mo></mml:mrow></mml:msup></mml:mrow></mml:math></inline-formula>)
were systematically analyzed in all samples, using respectively
high-performance liquid chromatography with pulsed amperometric detection
(HPLC-PAD) and ionic chromatography (IC; Thermo Fisher ICS 3000, USA).
Free-cellulose concentrations were determined using an optimized enzymatic
hydrolysis (Samaké et al.,
2019a) and the subsequent analysis method of the resultant glucose units
using HPLC-PAD
(Golly
et al., 2018; Samaké et al., 2019b; Waked et al., 2014). Organic and
elemental carbon (OC, EC) were analyzed using a Sunset thermal-optic
instrument and the EUSAAR2 protocol (Cavalli et al., 2010). This
analytical method requires a high temperature, thereby constraining the choice
of quartz as the sampling filter material. OM content in PM<inline-formula><mml:math id="M31" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> samples was
then estimated using an OM-to-OC conversion factor of 1.8: <inline-formula><mml:math id="M32" display="inline"><mml:mrow><mml:mi mathvariant="normal">OM</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">1.8</mml:mn><mml:mo>×</mml:mo><mml:mi mathvariant="normal">OC</mml:mi></mml:mrow></mml:math></inline-formula> (Samaké et al., 2019a, b). This value of
1.8 for the <inline-formula><mml:math id="M33" display="inline"><mml:mrow class="chem"><mml:mi mathvariant="normal">OM</mml:mi><mml:mo>/</mml:mo><mml:mi mathvariant="normal">OC</mml:mi></mml:mrow></mml:math></inline-formula> ratio was chosen on the basis of previous studies carried
out in France (Samaké et al., 2019b, and references therein)</p>
</sec>
<sec id="Ch1.S2.SS4">
  <label>2.4</label><?xmltex \opttitle{Biological analyses: DNA extraction in PM${}_{{10}}$ samples}?><title>Biological analyses: DNA extraction in PM<inline-formula><mml:math id="M34" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> samples</title>
      <p id="d1e628">Aerosol samples typically contain very low DNA concentrations, and the
DNA-binding properties of the quartz fibers of aerosol collection filters make
its extraction with traditional protocols challenging
(Dommergue et al., 2019; Jiang et al., 2015;
Luhung et al., 2015). In the present study, we were also constrained by the
limited daily collection filter surface for the simultaneous chemical
and microbiological analyses of the same filters. To circumvent issues of
low efficiency during genomic DNA extraction, several technical improvements
have been made to optimize the extraction of high-quality DNA from PM<inline-formula><mml:math id="M35" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula>
samples (Dommergue et al., 2019; Jiang et
al., 2015; Luhung et al., 2015). This includes thermal water bath sonication
helping the lysis process in thick cell walls (e.g., fungal spores and Gram-positive
bacteria), which might not be effectively lysed solely by means of bead
beating (Luhung et al., 2015). Some consecutive (2 d at
maximum) quartz filter samples with low OM concentrations were also pooled
when necessary. Detailed information regarding the resultant composite
samples (labeled A1 to A36) is presented in Table S1 in the Supplement. Figure S1 in the Supplement presents
the average concentration levels of SC species in each sample. The results
clearly show that air samples can be categorized from low (background, from
A1 to A4 and A21 to A36) to high (peak, from A5 to A20) PM<inline-formula><mml:math id="M36" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula>-SC
concentration levels.</p>
      <p id="d1e649">In terms of DNA extraction, one-quarter (about 38.5 cm<inline-formula><mml:math id="M37" display="inline"><mml:msup><mml:mi/><mml:mn mathvariant="normal">2</mml:mn></mml:msup></mml:math></inline-formula>) of each
filter sample was used. First, filter aliquots were aseptically inserted
into individual 50 mL Falcon tubes filed with sterilized saturated phosphate
buffer (<inline-formula><mml:math id="M38" display="inline"><mml:mrow class="chem"><mml:msub><mml:mi mathvariant="normal">Na</mml:mi><mml:mn mathvariant="normal">2</mml:mn></mml:msub><mml:msub><mml:mi mathvariant="normal">HPO</mml:mi><mml:mn mathvariant="normal">4</mml:mn></mml:msub></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M39" display="inline"><mml:mrow class="chem"><mml:msub><mml:mi mathvariant="normal">NaH</mml:mi><mml:mn mathvariant="normal">2</mml:mn></mml:msub><mml:msub><mml:mi mathvariant="normal">PO</mml:mi><mml:mn mathvariant="normal">4</mml:mn></mml:msub></mml:mrow></mml:math></inline-formula>, 0.12 M; <inline-formula><mml:math id="M40" display="inline"><mml:mrow><mml:mi mathvariant="normal">pH</mml:mi><mml:mo>≈</mml:mo><mml:mn mathvariant="normal">8</mml:mn></mml:mrow></mml:math></inline-formula>). PM<inline-formula><mml:math id="M41" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula>
was desorbed from the filter samples by gentle shaking for 10 min at 250 rpm. This
pretreatment allows the separation of the collected particles from the
quartz filters thanks to the high competing interaction between the saturated
phosphate buffer and the charged biological materials
(Jiang et al., 2015; Taberlet et al., 2018).
After gentle vortex mixing, the subsequent resuspension was filtered with a
polyethersulfone membrane
disk filter (Supor<sup>®</sup> PES 47 mm 200,
0.2 <inline-formula><mml:math id="M42" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>m, Pall, USA). We repeated this desorbing step three times to
enhance the recovery of the biological material from the quartz filters. Each
collection PES membrane was then shredded into small pieces and used for DNA
extractions using the DNeasy PowerWater kit (Qiagen, Germantown, MD, USA).
The standard protocol of the supplier was followed with only minor
modifications: 30 min of thermal water bath sonication at 65 <inline-formula><mml:math id="M43" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C
(EMAG, Emmi-60 HC, Germany; 50 % efficiency) and 5 min of bead<?pagebreak page5613?> beating
before and after sonication were added. Finally, DNA was eluted in
50 <inline-formula><mml:math id="M44" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>L of EB buffer.
Such an optimized protocol has been recently shown
to produce a 10-fold increase in DNA extraction efficiency
(Dommergue et al., 2019; Luhung et al., 2015),
thereby allowing high-throughput sequencing of air samples. Note that all
the steps mentioned above were performed under laminar flow hoods and that
materials (filter funnels, forceps, and scissors) were sterilized prior to
use.</p>
<sec id="Ch1.S2.SS4.SSS1">
  <label>2.4.1</label><title>Biological analyses: DNA extraction from soil and leaf samples</title>
      <p id="d1e750">The soil sample pretreatment and the extracellular DNA extraction were achieved
following an optimized protocol proposed elsewhere
(Taberlet et al., 2018). Briefly, this protocol
involves thoroughly mixing and extracting 15 g of soil in 15 mL of sterile
saturated phosphate buffer for 15 min. About 2 mL of the resulting extracts
was centrifuged for 10 min at 10 000 g, and 500 <inline-formula><mml:math id="M45" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>L of the resulting
supernatant was used for DNA extraction using the NucleoSpin Soil Kit
(Macherey-Nagel, Düren, Germany) following the manufacturer's original
protocol after skipping the cell lysis step. Finally, DNA was eluted with
100 <inline-formula><mml:math id="M46" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>L of SE buffer.</p>
      <p id="d1e769">To extract DNA from either endophytic or epiphytic microorganisms, aliquots
of leaf samples (about 25–30 mg) were extracted with the DNeasy Plant Mini
Kit (QIAGEN, Germany) according to the supplier's instructions with the
following minor modifications: after the resuspension of powdered samples in
400 <inline-formula><mml:math id="M47" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>L of AP1 buffer, the samples were incubated for 45 min at
65 <inline-formula><mml:math id="M48" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C with RNase A. Finally, DNA was eluted with 100 <inline-formula><mml:math id="M49" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>L of AE
buffer.</p>
</sec>
<sec id="Ch1.S2.SS4.SSS2">
  <label>2.4.2</label><title>Biological analyses: polymerase chain reaction amplification and sequencing</title>
      <p id="d1e806">Bacterial and fungal community compositions were surveyed using, respectively,
the Bact02 (Forward 5<inline-formula><mml:math id="M50" display="inline"><mml:msup><mml:mi/><mml:mo>′</mml:mo></mml:msup></mml:math></inline-formula>–KGCCAGCMGCCGCGGTAA–3<inline-formula><mml:math id="M51" display="inline"><mml:msup><mml:mi/><mml:mo>′</mml:mo></mml:msup></mml:math></inline-formula> and Reverse
3<inline-formula><mml:math id="M52" display="inline"><mml:msup><mml:mi/><mml:mo>′</mml:mo></mml:msup></mml:math></inline-formula>–GGACTACCMGGGTATCTAA–5<inline-formula><mml:math id="M53" display="inline"><mml:msup><mml:mi/><mml:mo>′</mml:mo></mml:msup></mml:math></inline-formula>) and Fung02 (Forward
5<inline-formula><mml:math id="M54" display="inline"><mml:msup><mml:mi/><mml:mo>′</mml:mo></mml:msup></mml:math></inline-formula>–GGAAGTAAAAGTCGTAACAAGG–3<inline-formula><mml:math id="M55" display="inline"><mml:msup><mml:mi/><mml:mo>′</mml:mo></mml:msup></mml:math></inline-formula> and Reverse
3<inline-formula><mml:math id="M56" display="inline"><mml:msup><mml:mi/><mml:mo>′</mml:mo></mml:msup></mml:math></inline-formula>–CAAGAGATCCGTTGYTGAAAGTK–5<inline-formula><mml:math id="M57" display="inline"><mml:msup><mml:mi/><mml:mo>′</mml:mo></mml:msup></mml:math></inline-formula>) published primer pairs (see
Taberlet et al., 2018, for details on these primers).
The primer pair Bact02 targets the V4 region of the bacterial 16S rDNA
region while the Fung02 primer pair targets the nuclear ribosomal internal
transcribed spacer region 1 (ITS1). Four independent PCR (polymerase chain reaction)
replicates were
carried out for each DNA extract. Eight nucleotide tags were added to both
primer ends to uniquely identify each sample, ensuring that each PCR
replicate was labeled by a unique combination of forward and reverse tags.
The tag sequences were created with the oligotag command within the open-source
OBITools software suite (Boyer et al., 2016) so
that all pairwise tag combinations were differentiated by at least five
different base pairs (Taberlet et al., 2018).</p>
      <p id="d1e882"><?xmltex \hack{\newpage}?>DNA amplification was performed in a 20 <inline-formula><mml:math id="M58" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>L total volume solution
containing 10 <inline-formula><mml:math id="M59" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>L of AmpliTaq Gold 360 Master Mix (Applied Biosystems, Foster City,
CA, USA), 0.16 <inline-formula><mml:math id="M60" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>L of 20 mg mL<inline-formula><mml:math id="M61" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula> bovine serum albumin (BSA; Roche
Diagnostics, Basel, Switzerland), 0.2 <inline-formula><mml:math id="M62" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>M of each primer, and 2 <inline-formula><mml:math id="M63" display="inline"><mml:mrow class="unit"><mml:mi mathvariant="normal">µ</mml:mi></mml:mrow></mml:math></inline-formula>L
of diluted DNA extract. DNA extracts from soil and filters were diluted
eight times, while DNA extracts from leaves were diluted four times.
Amplifications were performed using the following thermocycling program: an
initial activation of DNA polymerase for 10 min at 95 <inline-formula><mml:math id="M64" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C; <inline-formula><mml:math id="M65" display="inline"><mml:mi>x</mml:mi></mml:math></inline-formula> cycles
of 30 s denaturation at 95 <inline-formula><mml:math id="M66" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C, 30 s annealing at 53 <inline-formula><mml:math id="M67" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C
and 56 <inline-formula><mml:math id="M68" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for bacteria and fungi, respectively, and 90 s elongation at
72 <inline-formula><mml:math id="M69" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C; and a final extension at 72 <inline-formula><mml:math id="M70" display="inline"><mml:msup><mml:mi/><mml:mo>∘</mml:mo></mml:msup></mml:math></inline-formula>C for 7 min. The
number of cycles <inline-formula><mml:math id="M71" display="inline"><mml:mi>x</mml:mi></mml:math></inline-formula> was determined by qPCR and set at 40 for all markers and
DNA extract types, except for the Bact02 amplification of soil and leaf
samples (30 cycles) and the Fung02 amplification of filter samples (42
cycles). After amplification, about 10 % of amplification products were
randomly selected and verified using a QIAxcel Advanced device (QIAGEN,
Hilden, Germany) equipped with a high-resolution cartridge for separation.</p>
      <p id="d1e1008">After amplification, PCR products from the same marker were pooled in equal
volumes and cleaned with the MinElute PCR purification kit (Qiagen, Hilden,
Germany), following the manufacturer's instructions. The two pools were sent
to Fasteris SA (Geneva, Switzerland; <uri>https://www.fasteris.com/dna/</uri>, last
access: 10 December  2019) for library preparation and MiSeq Illumina
<inline-formula><mml:math id="M72" display="inline"><mml:mrow><mml:mn mathvariant="normal">2</mml:mn><mml:mo>×</mml:mo><mml:mn mathvariant="normal">250</mml:mn></mml:mrow></mml:math></inline-formula> bp paired-end sequencing. The two sequencing libraries (one
per marker) were prepared according to the PCR-free MetaFast protocol
(<uri>https://www.fasteris.com/dna/?q=content/metafast-protocol-amplicon-metagenomic-analysis</uri>, last access: 10 May 2020), which aims at
limiting the formation of chimeras.</p>
      <p id="d1e1029">To monitor any potential false positives inherent to tag jumps and
contamination (Schnell et al., 2015), the sequencing experiment
included both extraction and PCR negatives, as well as
unused tag combinations.</p>
</sec>
<sec id="Ch1.S2.SS4.SSS3">
  <label>2.4.3</label><title>Bioinformatic analyses of raw reads</title>
      <p id="d1e1040">The Illumina raw sequence reads were processed separately for each library
using the OBITools software suite (Boyer et al.,
2016), specifically dedicated to metabarcoding data processing. First, the
raw paired-ends were assembled using the illuminapairedend program, and the sequences with a
low alignment score (fastq average quality score <inline-formula><mml:math id="M73" display="inline"><mml:mrow><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">40</mml:mn></mml:mrow></mml:math></inline-formula>) were
discarded. The aligned sequences were then assigned to the corresponding PCR
replicates with the program ngsfilter by allowing zero and two mismatches on tags and
primers, respectively. Strictly identical sequences were dereplicated using
the program obuniq, and a basic filtration step was performed with the obigrep program to
select sequences within the expected range length (i.e., longer than 65 and
39 bp for fungi and bacteria, respectively, excluding tags and<?pagebreak page5614?> primers),
without ambiguous nucleotides, and observed at least 10 times in at least
one PCR replicate.</p>
      <p id="d1e1053">The remaining unique sequences were grouped and assigned to molecular operational
taxonomic units (MOTUs) with a 97 % sequence identity using the Sumatra and
Sumaclust programs (Mercier et al., 2013). The Sumatra algorithm computes
pairwise similarities among sequences based on the length of the longest
common subsequence, and the Sumaclust program uses these similarities to cluster the
sequences (Mercier et al., 2013). An abundance of sequences
belonging to the same cluster was summed up, and the cluster center was
defined as the MOTU representative of the cluster (Mercier et
al., 2013).</p>
      <p id="d1e1056">The taxonomic classification of each MOTU was performed using the ecotag program
(Boyer et al., 2016), which uses full-length
metabarcodes as references. The ecoPCR program
(Ficetola et al., 2010) was used to build the
metabarcode reference database for each marker. Briefly, ecoPCR performs
an in silico amplification within the EMBL public database (release 133), using the
Fung02 and Bact02 primer pairs and allowing a maximum of three mismatches
per primer. The resultant reference database was further refined by keeping
only sequence records assigned at the species, genus, and family levels.</p>
      <p id="d1e1059">After taxonomic assignment, data sets were acquired, and further processing with
the open-source R software (RStudio interface, version 3.4.1) was performed
to filter out chimeras, potential contaminants, and failed PCR
replicates. More specifically, MOTUs that were highly dissimilar to any
reference sequence (sequence identity <inline-formula><mml:math id="M74" display="inline"><mml:mrow><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.95</mml:mn></mml:mrow></mml:math></inline-formula>) were considered
chimeras and discarded. Secondly, MOTUs whose abundance was higher in
extraction and PCR negatives were also excluded. Finally, PCR replicates
inconstantly distant from the barycenter of the four PCR replicates
corresponding to the same sample were considered dysfunctional and
discarded. The remaining PCR replicates were summed up per sample.</p>
</sec>
</sec>
<sec id="Ch1.S2.SS5">
  <label>2.5</label><title>Data analysis</title>
      <p id="d1e1082">Unless specified otherwise, all exploratory statistical analyses were
achieved with R. Rarefaction and extrapolation curves were obtained with the
iNEXT 2.0-12 package (Hsieh et
al., 2016) to investigate the gain in species richness as we increased the
sequencing depth for each sample. Alpha diversity estimators including
Shannon and Chao1 were calculated with the phyloseq 1.22-3 package
(McMurdie and Holmes, 2013) on data rarefied to
the same sequencing depth per sample type (see Table S2 for details on the
rarefaction depths). Nonmetric multidimensional scaling (NMDS) ordination
analysis was performed to decipher the temporal patterns in airborne
microbial community structures (phylum or class taxonomic group) in air
samples. These analyses were achieved with the metaMDS function within the vegan package
(Oksanen et al., 2019) with the number of random starts set
to 500. The NMDS ordinations were obtained using pairwise dissimilarity
matrices based on Bray–Curtis index. The envfit function implemented in vegan was
used to assess the airborne microbial communities, which could explain the
temporal dynamics of ambient SC species concentrations. Pairwise analysis of
similarity (ANOSIM) was performed to assess similarity between groups of
PM<inline-formula><mml:math id="M75" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> aerosol samples. This was achieved using the anosim function of vegan
(Oksanen et al., 2019) with the number of permutations
set to 999. Spearman's rank correlation analysis was used to investigate
further the relationship between airborne microbial communities and SC
species.</p>
      <p id="d1e1094">To gain further insight into the dominant source of SC-associated microbial
communities, NMDS analysis based on Horn distance was performed to compare
the microbial community composition similarities between PM<inline-formula><mml:math id="M76" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> aerosol, soil, and leaf samples.</p>
</sec>
</sec>
<sec id="Ch1.S3">
  <label>3</label><title>Results</title>
<sec id="Ch1.S3.SS1">
  <label>3.1</label><title>Primary sugar compounds and relative contributions to OM mass</title>
      <p id="d1e1122">Temporal dynamics of daily PM<inline-formula><mml:math id="M77" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> carbonaceous components (e.g., primary
sugar compounds, cellulose, and OM) are presented in Fig. 2. Nine SCs
including seven polyols and two saccharide compounds have been quantified in
all ambient PM<inline-formula><mml:math id="M78" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> collected at the study site. Ambient SC concentration
levels peaked on 8 August 2017 in excellent agreement with the
daily harvest activities around the study site (Fig. 2a). The average
concentration (average <inline-formula><mml:math id="M79" display="inline"><mml:mo>±</mml:mo></mml:math></inline-formula> SD) of total SCs during the campaign is
<inline-formula><mml:math id="M80" display="inline"><mml:mrow><mml:mn mathvariant="normal">259.8</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">253.8</mml:mn></mml:mrow></mml:math></inline-formula> ng m<inline-formula><mml:math id="M81" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">3</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula> with a range of 26.6 to 1679.5 ng m<inline-formula><mml:math id="M82" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">3</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>,
contributing on average to <inline-formula><mml:math id="M83" display="inline"><mml:mrow><mml:mn mathvariant="normal">5.7</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">3.2</mml:mn></mml:mrow></mml:math></inline-formula> % of total OM mass in
PM<inline-formula><mml:math id="M84" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> with a range of 0.8–13.5 % (Fig. 2b). The total measured
polyols present an average concentration of <inline-formula><mml:math id="M85" display="inline"><mml:mrow><mml:mn mathvariant="normal">26.3</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">54.4</mml:mn></mml:mrow></mml:math></inline-formula> ng m<inline-formula><mml:math id="M86" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">3</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>.
Among all the measured polyols, arabitol (<inline-formula><mml:math id="M87" display="inline"><mml:mrow><mml:mn mathvariant="normal">67.4</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">83.1</mml:mn></mml:mrow></mml:math></inline-formula> ng m<inline-formula><mml:math id="M88" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">3</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>) and
mannitol (<inline-formula><mml:math id="M89" display="inline"><mml:mrow><mml:mn mathvariant="normal">68.1</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">75.3</mml:mn></mml:mrow></mml:math></inline-formula> ng m<inline-formula><mml:math id="M90" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">3</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>) are the predominant species,
followed by lesser amounts of sorbitol (<inline-formula><mml:math id="M91" display="inline"><mml:mrow><mml:mn mathvariant="normal">10.9</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">7.6</mml:mn></mml:mrow></mml:math></inline-formula> ng m<inline-formula><mml:math id="M92" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">3</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>),
erythritol (<inline-formula><mml:math id="M93" display="inline"><mml:mrow><mml:mn mathvariant="normal">7.0</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">8.8</mml:mn></mml:mrow></mml:math></inline-formula> ng m<inline-formula><mml:math id="M94" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">3</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>), inositol (<inline-formula><mml:math id="M95" display="inline"><mml:mrow><mml:mn mathvariant="normal">2.3</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">2.0</mml:mn></mml:mrow></mml:math></inline-formula> ng m<inline-formula><mml:math id="M96" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">3</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>), and xylitol (<inline-formula><mml:math id="M97" display="inline"><mml:mrow><mml:mn mathvariant="normal">2.3</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">3.0</mml:mn></mml:mrow></mml:math></inline-formula> ng m<inline-formula><mml:math id="M98" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">3</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>). Glycerol was also
observed in our samples but with concentrations frequently below the
quantification limit. The average concentration of saccharide compounds is
<inline-formula><mml:math id="M99" display="inline"><mml:mrow><mml:mn mathvariant="normal">51.2</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">45.0</mml:mn></mml:mrow></mml:math></inline-formula> ng m<inline-formula><mml:math id="M100" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">3</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>. Trehalose (<inline-formula><mml:math id="M101" display="inline"><mml:mrow><mml:mn mathvariant="normal">55.8</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">51.9</mml:mn></mml:mrow></mml:math></inline-formula> ng m<inline-formula><mml:math id="M102" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">3</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>) is
the most abundant saccharide species, followed by glucose (<inline-formula><mml:math id="M103" display="inline"><mml:mrow><mml:mn mathvariant="normal">46.9</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">37.1</mml:mn></mml:mrow></mml:math></inline-formula> ng m<inline-formula><mml:math id="M104" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">3</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>).
The average concentration of calcium is <inline-formula><mml:math id="M105" display="inline"><mml:mrow><mml:mn mathvariant="normal">251.1</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">248.4</mml:mn></mml:mrow></mml:math></inline-formula> ng m<inline-formula><mml:math id="M106" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">3</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>.</p>

      <?xmltex \floatpos{t}?><fig id="Ch1.F2" specific-use="star"><?xmltex \currentcnt{2}?><label>Figure 2</label><caption><p id="d1e1478">Ambient concentrations of carbonaceous components in PM<inline-formula><mml:math id="M107" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula>.  <bold>(a, c–f)</bold> Daily variations in SC and calcium concentrations along with
daily agricultural activities around the site. <bold>(b)</bold> Contribution of SCs to
organic matter mass. Results for 9-week daily measurements indicate that
SCs together represent a large fraction of OM, contributing to between 0.8 % to
13.5 % of OM mass in summer. Glycerol is not presented because its
concentration was generally below the quantification limit.</p></caption>
          <?xmltex \igopts{width=426.791339pt}?><graphic xlink:href="https://acp.copernicus.org/articles/20/5609/2020/acp-20-5609-2020-f02.png"/>

        </fig>

      <?pagebreak page5615?><p id="d1e1502">A Spearman's rank correlation analysis based on the daily dynamics was used
to examine the relationships between SC species. As shown in Table 1,
sorbitol and inositol are well-correlated linearly  (<inline-formula><mml:math id="M108" display="inline"><mml:mrow><mml:mi>R</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.57</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M109" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.001</mml:mn></mml:mrow></mml:math></inline-formula>). Herein, sorbitol (<inline-formula><mml:math id="M110" display="inline"><mml:mrow><mml:mi>R</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.59</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M111" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.001</mml:mn></mml:mrow></mml:math></inline-formula>) and inositol (<inline-formula><mml:math id="M112" display="inline"><mml:mrow><mml:mi>R</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.64</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M113" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.001</mml:mn></mml:mrow></mml:math></inline-formula>) are significantly correlated to <inline-formula><mml:math id="M114" display="inline"><mml:mrow class="chem"><mml:msup><mml:mi mathvariant="normal">Ca</mml:mi><mml:mrow><mml:mn mathvariant="normal">2</mml:mn><mml:mo>+</mml:mo></mml:mrow></mml:msup></mml:mrow></mml:math></inline-formula>. It can
also be noted that all other SC species are highly correlated with each
other (<inline-formula><mml:math id="M115" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.001</mml:mn></mml:mrow></mml:math></inline-formula>) and that they are weakly correlated to the
temporal dynamics of sorbitol and inositol (Table 1).</p>

<?xmltex \floatpos{t}?><table-wrap id="Ch1.T1" specific-use="star"><?xmltex \currentcnt{1}?><label>Table 1</label><caption><p id="d1e1608">Relationships between SCs and calcium in PM<inline-formula><mml:math id="M116" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> from the study
site. Spearman's rank correlation analyses are based on the daily dynamics
of chemical species (<inline-formula><mml:math id="M117" display="inline"><mml:mrow><mml:mi>n</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">69</mml:mn></mml:mrow></mml:math></inline-formula>).</p></caption><oasis:table frame="topbot"><oasis:tgroup cols="10">
     <oasis:colspec colnum="1" colname="col1" align="left"/>
     <oasis:colspec colnum="2" colname="col2" align="left"/>
     <oasis:colspec colnum="3" colname="col3" align="left"/>
     <oasis:colspec colnum="4" colname="col4" align="left"/>
     <oasis:colspec colnum="5" colname="col5" align="left"/>
     <oasis:colspec colnum="6" colname="col6" align="left"/>
     <oasis:colspec colnum="7" colname="col7" align="left"/>
     <oasis:colspec colnum="8" colname="col8" align="left"/>
     <oasis:colspec colnum="9" colname="col9" align="left"/>
     <oasis:colspec colnum="10" colname="col10" align="left"/>
     <oasis:thead>
       <oasis:row rowsep="1">
         <oasis:entry colname="col1"/>
         <oasis:entry colname="col2">Arabitol</oasis:entry>
         <oasis:entry colname="col3">Mannitol</oasis:entry>
         <oasis:entry colname="col4">Glucose</oasis:entry>
         <oasis:entry colname="col5">Trehalose</oasis:entry>
         <oasis:entry colname="col6">Erythritol</oasis:entry>
         <oasis:entry colname="col7">Xylitol</oasis:entry>
         <oasis:entry colname="col8">Sorbitol</oasis:entry>
         <oasis:entry colname="col9">Inositol</oasis:entry>
         <oasis:entry colname="col10"><inline-formula><mml:math id="M124" display="inline"><mml:mrow class="chem"><mml:msup><mml:mi mathvariant="normal">Ca</mml:mi><mml:mrow><mml:mn mathvariant="normal">2</mml:mn><mml:mo>+</mml:mo></mml:mrow></mml:msup></mml:mrow></mml:math></inline-formula></oasis:entry>
       </oasis:row>
     </oasis:thead>
     <oasis:tbody>
       <oasis:row>
         <oasis:entry colname="col1">Arabitol</oasis:entry>
         <oasis:entry colname="col2">1.00</oasis:entry>
         <oasis:entry colname="col3"/>
         <oasis:entry colname="col4"/>
         <oasis:entry colname="col5"/>
         <oasis:entry colname="col6"/>
         <oasis:entry colname="col7"/>
         <oasis:entry colname="col8"/>
         <oasis:entry colname="col9"/>
         <oasis:entry colname="col10"/>
       </oasis:row>
       <oasis:row>
         <oasis:entry colname="col1">Mannitol</oasis:entry>
         <oasis:entry colname="col2">0.94<inline-formula><mml:math id="M125" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col3">1.00</oasis:entry>
         <oasis:entry colname="col4"/>
         <oasis:entry colname="col5"/>
         <oasis:entry colname="col6"/>
         <oasis:entry colname="col7"/>
         <oasis:entry colname="col8"/>
         <oasis:entry colname="col9"/>
         <oasis:entry colname="col10"/>
       </oasis:row>
       <oasis:row>
         <oasis:entry colname="col1">Glucose</oasis:entry>
         <oasis:entry colname="col2">0.90<inline-formula><mml:math id="M126" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col3">0.90<inline-formula><mml:math id="M127" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col4">1.00</oasis:entry>
         <oasis:entry colname="col5"/>
         <oasis:entry colname="col6"/>
         <oasis:entry colname="col7"/>
         <oasis:entry colname="col8"/>
         <oasis:entry colname="col9"/>
         <oasis:entry colname="col10"/>
       </oasis:row>
       <oasis:row>
         <oasis:entry colname="col1">Trehalose</oasis:entry>
         <oasis:entry colname="col2">0.93<inline-formula><mml:math id="M128" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col3">0.96<inline-formula><mml:math id="M129" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col4">0.87<inline-formula><mml:math id="M130" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col5">1.00</oasis:entry>
         <oasis:entry colname="col6"/>
         <oasis:entry colname="col7"/>
         <oasis:entry colname="col8"/>
         <oasis:entry colname="col9"/>
         <oasis:entry colname="col10"/>
       </oasis:row>
       <oasis:row>
         <oasis:entry colname="col1">Erythritol</oasis:entry>
         <oasis:entry colname="col2">0.69<inline-formula><mml:math id="M131" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col3">0.51<inline-formula><mml:math id="M132" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col4">0.57<inline-formula><mml:math id="M133" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col5">0.56<inline-formula><mml:math id="M134" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col6">1.00</oasis:entry>
         <oasis:entry colname="col7"/>
         <oasis:entry colname="col8"/>
         <oasis:entry colname="col9"/>
         <oasis:entry colname="col10"/>
       </oasis:row>
       <oasis:row>
         <oasis:entry colname="col1">Xylitol</oasis:entry>
         <oasis:entry colname="col2">0.84<inline-formula><mml:math id="M135" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col3">0.84<inline-formula><mml:math id="M136" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col4">0.80<inline-formula><mml:math id="M137" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col5">0.79<inline-formula><mml:math id="M138" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col6">0.65<inline-formula><mml:math id="M139" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col7">1.00</oasis:entry>
         <oasis:entry colname="col8"/>
         <oasis:entry colname="col9"/>
         <oasis:entry colname="col10"/>
       </oasis:row>
       <oasis:row>
         <oasis:entry colname="col1">Sorbitol</oasis:entry>
         <oasis:entry colname="col2">0.22</oasis:entry>
         <oasis:entry colname="col3">0.26<inline-formula><mml:math id="M140" display="inline"><mml:msup><mml:mi/><mml:mo>∗</mml:mo></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col4">0.35<inline-formula><mml:math id="M141" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col5">0.15</oasis:entry>
         <oasis:entry colname="col6">0.21</oasis:entry>
         <oasis:entry colname="col7">0.24<inline-formula><mml:math id="M142" display="inline"><mml:msup><mml:mi/><mml:mo>∗</mml:mo></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col8">1.00</oasis:entry>
         <oasis:entry colname="col9"/>
         <oasis:entry colname="col10"/>
       </oasis:row>
       <oasis:row>
         <oasis:entry colname="col1">Inositol</oasis:entry>
         <oasis:entry colname="col2">0.39<inline-formula><mml:math id="M143" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col3">0.24</oasis:entry>
         <oasis:entry colname="col4">0.34<inline-formula><mml:math id="M144" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col5">0.25<inline-formula><mml:math id="M145" display="inline"><mml:msup><mml:mi/><mml:mo>∗</mml:mo></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col6">0.71<inline-formula><mml:math id="M146" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col7">0.39<inline-formula><mml:math id="M147" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col8">0.57<inline-formula><mml:math id="M148" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col9">1.00</oasis:entry>
         <oasis:entry colname="col10"/>
       </oasis:row>
       <oasis:row>
         <oasis:entry colname="col1"><inline-formula><mml:math id="M149" display="inline"><mml:mrow class="chem"><mml:msup><mml:mi mathvariant="normal">Ca</mml:mi><mml:mrow><mml:mn mathvariant="normal">2</mml:mn><mml:mo>+</mml:mo></mml:mrow></mml:msup></mml:mrow></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col2">0.12</oasis:entry>
         <oasis:entry colname="col3">0.11</oasis:entry>
         <oasis:entry colname="col4">0.11</oasis:entry>
         <oasis:entry colname="col5">0.09</oasis:entry>
         <oasis:entry colname="col6">0.30<inline-formula><mml:math id="M150" display="inline"><mml:msup><mml:mi/><mml:mo>∗</mml:mo></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col7">0.27<inline-formula><mml:math id="M151" display="inline"><mml:msup><mml:mi/><mml:mo>∗</mml:mo></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col8">0.59<inline-formula><mml:math id="M152" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col9">0.64<inline-formula><mml:math id="M153" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula></oasis:entry>
         <oasis:entry colname="col10">1.00</oasis:entry>
       </oasis:row>
     </oasis:tbody>
   </oasis:tgroup></oasis:table><table-wrap-foot><p id="d1e1632">Note:
<inline-formula><mml:math id="M118" display="inline"><mml:msup><mml:mi/><mml:mo>∗</mml:mo></mml:msup></mml:math></inline-formula> <inline-formula><mml:math id="M119" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.1</mml:mn></mml:mrow></mml:math></inline-formula>,
<inline-formula><mml:math id="M120" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula> <inline-formula><mml:math id="M121" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula>,
<inline-formula><mml:math id="M122" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo><mml:mo>∗</mml:mo></mml:mrow></mml:msup></mml:math></inline-formula> <inline-formula><mml:math id="M123" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.001</mml:mn></mml:mrow></mml:math></inline-formula></p></table-wrap-foot></table-wrap>

</sec>
<sec id="Ch1.S3.SS2">
  <label>3.2</label><title>Microbial characterization of samples, richness and diversity</title>
      <p id="d1e2406">The structures of bacterial and fungal communities were generated for the 62
collected samples, consisting of 36 aerosol, 18 surface soil, and 8 leaf
samples. After paired-end assembly of sequence reads, sample assignment,
filtering based on sequence length and quality, and discarding rare
sequences, we are left with 2 575 857 and 1 647 000 reads respectively for
fungi and bacteria, corresponding to 4762 and 5852 unique
sequences, respectively. After the clustering of high-quality sequences,
potential contaminants, and chimeras, the final data sets (all samples
pooled) consist respectively of 597 and 944 MOTUs for fungi and bacteria,
with 1 959 549 and 901 539 reads. The average number of reads (average
<inline-formula><mml:math id="M154" display="inline"><mml:mo>±</mml:mo></mml:math></inline-formula> SE) per sample is <inline-formula><mml:math id="M155" display="inline"><mml:mrow><mml:mn mathvariant="normal">31</mml:mn><mml:mspace linebreak="nobreak" width="0.125em"/><mml:mn mathvariant="normal">607</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">2072</mml:mn></mml:mrow></mml:math></inline-formula> and <inline-formula><mml:math id="M156" display="inline"><mml:mrow><mml:mn mathvariant="normal">14</mml:mn><mml:mspace linebreak="nobreak" width="0.125em"/><mml:mn mathvariant="normal">563</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">1221</mml:mn></mml:mrow></mml:math></inline-formula> for fungi and bacteria,
respectively. The rarefaction curves of MOTU diversity showed common
logarithmic shapes approaching a plateau in all cases (Fig. S2). This
indicates an overall sufficient sequencing depth to capture the diversity of
sequences occurring in the different types of samples. To compare the
microbial community diversity and species richness, data normalization was
performed by randomly  selecting from<?pagebreak page5616?> each sample 4287 fungal sequence reads
and 2 865 bacterial sequence reads. The Chao1 values of fungi are higher for
aerosol samples than for soil and leaf samples (<inline-formula><mml:math id="M157" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.05</mml:mn></mml:mrow></mml:math></inline-formula>), indicating
higher richness in airborne PM<inline-formula><mml:math id="M158" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> (Fig. S3a). In contrast, PM<inline-formula><mml:math id="M159" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> and
soil samples showed higher values of Shannon index (<inline-formula><mml:math id="M160" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.05</mml:mn></mml:mrow></mml:math></inline-formula>),
indicating a higher fungal diversity in these ecosystems. The soil harbors
higher bacterial richness and diversity than PM<inline-formula><mml:math id="M161" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> (<inline-formula><mml:math id="M162" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.05</mml:mn></mml:mrow></mml:math></inline-formula>),
which in turn harbors greater richness and diversity compared to leaf
samples (<inline-formula><mml:math id="M163" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.05</mml:mn></mml:mrow></mml:math></inline-formula>) (Fig. S3b).</p>
</sec>
<sec id="Ch1.S3.SS3">
  <label>3.3</label><?xmltex \opttitle{Taxonomic composition of airborne PM${}_{{10}}$}?><title>Taxonomic composition of airborne PM<inline-formula><mml:math id="M164" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula></title>
<sec id="Ch1.S3.SS3.SSS1">
  <label>3.3.1</label><title>Fungal communities</title>
      <p id="d1e2546">The statistical assignment of airborne PM<inline-formula><mml:math id="M165" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> fungal MOTUs at different
taxonomic levels reveals 3 phyla, 17 classes, 58 orders, and 160 families
(Fig. 3). Interestingly, fungal MOTUs are dominated by two common phyla:
Ascomycota (accounting for an average of <inline-formula><mml:math id="M166" display="inline"><mml:mrow><mml:mn mathvariant="normal">76</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">20.4</mml:mn></mml:mrow></mml:math></inline-formula> % (average
<inline-formula><mml:math id="M167" display="inline"><mml:mo>±</mml:mo></mml:math></inline-formula> SD) of fungal sequences across all air samples), followed by
Basidiomycota (<inline-formula><mml:math id="M168" display="inline"><mml:mrow><mml:mn mathvariant="normal">23.9</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">20.4</mml:mn></mml:mrow></mml:math></inline-formula> %). The remaining sequences correspond to
Mucoromycota (<inline-formula><mml:math id="M169" display="inline"><mml:mrow><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula> %) and to unclassified sequences
(approximately 0.03 %). As evidenced in Fig. 3, the predominant
(<inline-formula><mml:math id="M170" display="inline"><mml:mrow><mml:mi mathvariant="italic">&gt;</mml:mi><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:math></inline-formula> %) fungal classes are Dothideomycetes (70.0 %), followed
by Agaricomycetes (16.0 %), Tremellomycetes (5.0 %), Sordariomycetes
(2.6 %), Microbotryomycetes (2.2 %), Leotiomycetes (1.8 %), and
Eurotiomycetes (1.4 %). The predominant orders include Pleosporales (35.5 %) and Capnodiales (34.4 %), which belong to Ascomycota. Likewise, the
dominant orders in Basidiomycota are Polyporales (7.5 %), followed by
Russulales (4.2 %), Tremellales (2.8 %), Hymenochaetales (2.6 %), and
Sporidiobolales (2.2 %). At the genus level, about 327 taxa are
characterized across all air samples, among which <italic>Cladosporium</italic> (32.9 %), <italic>Alternaria</italic> (15.0 %),
<italic>Epicoccum</italic> (15.0 %), <italic>Peniophora</italic> (2.7 %), <italic>Sporobolomyces</italic> (2.2 %), <italic>Phlebia</italic> (2.0 %), and <italic>Pyrenophora</italic> (1.9 %) are the
most abundant communities.</p>

      <?xmltex \floatpos{t}?><fig id="Ch1.F3"><?xmltex \currentcnt{3}?><label>Figure 3</label><caption><p id="d1e2634">Taxonomic and phylogenetic trees of fungal and bacterial community
structures in PM<inline-formula><mml:math id="M171" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> at the study site. Phylogenetic trees are analyzed
with the Environment for Tree Exploration (ETE3) package implemented in
Python (Huerta-Cepas et al., 2016). The circle from the
inner to the outer layer represents classification from kingdom to order
successively. Further details on fungal and bacterial taxa at genus level
are provided in Fig. S4. The node size represents the average relative
abundance of taxa. Only nodes with relative abundance <inline-formula><mml:math id="M172" display="inline"><mml:mrow><mml:mo>≥</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:math></inline-formula> are
highlighted in bold.</p></caption>
            <?xmltex \igopts{width=236.157874pt}?><graphic xlink:href="https://acp.copernicus.org/articles/20/5609/2020/acp-20-5609-2020-f03.png"/>

          </fig>

<?xmltex \hack{\newpage}?>
</sec>
<sec id="Ch1.S3.SS3.SSS2">
  <label>3.3.2</label><title>Bacterial communities</title>
      <p id="d1e2672">For bacterial communities, the Bact02 marker allowed 17 phyla,
43 classes, 91 orders, and 182 families to be identified (Fig. 3). Predominant phyla include
Proteobacteria (<inline-formula><mml:math id="M173" display="inline"><mml:mrow><mml:mn mathvariant="normal">55.3</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">8.6</mml:mn></mml:mrow></mml:math></inline-formula> %), followed by Bacteroidetes (<inline-formula><mml:math id="M174" display="inline"><mml:mrow><mml:mn mathvariant="normal">22.1</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">4.1</mml:mn></mml:mrow></mml:math></inline-formula> %), Actinobacteria (<inline-formula><mml:math id="M175" display="inline"><mml:mrow><mml:mn mathvariant="normal">14.2</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">2.2</mml:mn></mml:mrow></mml:math></inline-formula> %), and Firmicutes (<inline-formula><mml:math id="M176" display="inline"><mml:mrow><mml:mn mathvariant="normal">6</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">5.9</mml:mn></mml:mrow></mml:math></inline-formula> %), with less than 1.8 % of the total bacterial sequence reads
being unclassified. At the class level, the predominant bacteria are
Alphaproteobacteria (29.4 %), Actinobacteria (13.8 %),
Gammaproteobacteria (12.1 %), Betaproteobacteria (11.4 %), Cytophagia
(8.3 %), Flavobacteriia (6.3 %), Sphingobacteriia (5.9 %), Bacilli
(3.5 %), and Clostridia (2.2 %). As many as 392 genera were detected in
all aerosol samples, although many sequences (22.8 %) could not be
taxonomically assigned at the genus level. The most abundant (<inline-formula><mml:math id="M177" display="inline"><mml:mrow><mml:mi mathvariant="italic">&gt;</mml:mi><mml:mn mathvariant="normal">2</mml:mn></mml:mrow></mml:math></inline-formula> %) genera are <italic>Sphingomonas</italic> (20.0 %), followed by <italic>Massilia</italic> (8.4 %), <italic>Hymenobacter</italic> (5.5 %),
<italic>Pseudomonas</italic> (5.1 %), <italic>Pedobacter</italic> (3.3 %), <italic>Flavobacterium</italic> (2.8 %), <italic>Chryseobacterium</italic> (2.8 %), <italic>Frigoribacterium </italic>(2.5 %), and
<italic>Methylobacterium</italic> (1.9 %).</p>
</sec>
</sec>
<sec id="Ch1.S3.SS4">
  <label>3.4</label><?xmltex \opttitle{Relationship between airborne microbial community abundances and PM${}_{{10}}$
SC species}?><title>Relationship between airborne microbial community abundances and PM<inline-formula><mml:math id="M178" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula>
SC species</title>
      <p id="d1e2781">The NMDS (nonmetric multidimensional scaling) ordination exploring the
temporal dynamics of microbial community beta diversity among all PM<inline-formula><mml:math id="M179" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula>
aerosol samples revealed significant temporal shifts in community structure
for both fungi and bacteria (Fig. 4).</p>
      <p id="d1e2793">An NMDS (two dimensions, stress <inline-formula><mml:math id="M180" display="inline"><mml:mo>=</mml:mo></mml:math></inline-formula> 0.15) based on fungal class-level
compositions (Fig. 4a) results in three distinct clusters of PM<inline-formula><mml:math id="M181" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula>
samples. With one exception (A23), all air samples with higher SC
concentration levels (A5 to A20, see Table S2 and Fig. S1) are clustered
together and are distinct from those with background levels of atmospheric
SC concentrations. This pattern is further confirmed with the analysis of
similarity, which shows a significant separation of clusters of samples
(ANOSIM, <inline-formula><mml:math id="M182" display="inline"><mml:mrow><mml:mi>R</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.31</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M183" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula>). As evidenced in Fig. 4a, this
difference is<?pagebreak page5617?> mainly explained by the NMDS1 axis, which results from the
predominance of only a few class-level fungi in PM<inline-formula><mml:math id="M184" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> samples, including
<italic>Dothideomycetes</italic>, <italic>Tremellomycetes</italic>, <italic>Microbotryomycetes</italic>, and <italic>Exobasidiomycetes</italic>. Vector fitting of chemical time series data to the NMDS
ordination plot indicates that the latter four fungal community assemblages
best correlate with individual SC species. Mannitol (<inline-formula><mml:math id="M185" display="inline"><mml:mrow><mml:msup><mml:mi>R</mml:mi><mml:mn mathvariant="normal">2</mml:mn></mml:msup><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.37</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M186" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula>), arabitol (<inline-formula><mml:math id="M187" display="inline"><mml:mrow><mml:msup><mml:mi>R</mml:mi><mml:mn mathvariant="normal">2</mml:mn></mml:msup><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.36</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M188" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula>), trehalose
(<inline-formula><mml:math id="M189" display="inline"><mml:mrow><mml:msup><mml:mi>R</mml:mi><mml:mn mathvariant="normal">2</mml:mn></mml:msup><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.41</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M190" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula>), glucose (<inline-formula><mml:math id="M191" display="inline"><mml:mrow><mml:msup><mml:mi>R</mml:mi><mml:mn mathvariant="normal">2</mml:mn></mml:msup><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.33</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M192" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula>), xylitol (<inline-formula><mml:math id="M193" display="inline"><mml:mrow><mml:msup><mml:mi>R</mml:mi><mml:mn mathvariant="normal">2</mml:mn></mml:msup><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.45</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M194" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula>), erythritol (<inline-formula><mml:math id="M195" display="inline"><mml:mrow><mml:msup><mml:mi>R</mml:mi><mml:mn mathvariant="normal">2</mml:mn></mml:msup><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.40</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M196" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula>), and inositol (<inline-formula><mml:math id="M197" display="inline"><mml:mrow><mml:msup><mml:mi>R</mml:mi><mml:mn mathvariant="normal">2</mml:mn></mml:msup><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.24</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M198" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula>) are
significantly positively correlated to the fungal assemblage ordination
solution.</p>

      <?xmltex \floatpos{t}?><fig id="Ch1.F4" specific-use="star"><?xmltex \currentcnt{4}?><label>Figure 4</label><caption><p id="d1e3051">Main airborne microbial communities associated with atmospheric
concentrations of SC species. NMDS ordination plots are used to show the
relationship among time series of aerosol samples. The stress values
indicate an adequate two-dimensional picture of sample distribution. Ellipses
represent 95 % confidence intervals for the cluster centroid. NMDS
analyses are performed directly on taxonomically assigned quality-filtered
sequence tables at class and phylum level for fungi <bold>(a)</bold> and
bacteria <bold>(b)</bold>, respectively. Ambient primary sugar concentration levels in PM<inline-formula><mml:math id="M199" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> appear
to be highly influenced by the airborne microbial community structure and
abundance. Similar results are obtained with taxonomically assigned MOTU
tables, highlighting the robustness of our methodology.</p></caption>
          <?xmltex \igopts{width=398.338583pt}?><graphic xlink:href="https://acp.copernicus.org/articles/20/5609/2020/acp-20-5609-2020-f04.png"/>

        </fig>

      <p id="d1e3076">For bacterial phylum-level compositions (Fig. 4b), an NMDS ordination (two
dimensions, stress <inline-formula><mml:math id="M200" display="inline"><mml:mo>=</mml:mo></mml:math></inline-formula> 0.07) analysis differentiates the PM<inline-formula><mml:math id="M201" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> samples
into two distinct clusters according to their SC concentration levels. All
air samples with higher SC concentration levels except two (A23 and A24) are
clustered separately from those with ambient background concentration
levels. ANOSIM analysis (<inline-formula><mml:math id="M202" display="inline"><mml:mrow><mml:mi>R</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.69</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M203" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula>) further confirms the
significant difference between the two clusters of samples. Proteobacteria
constitute the most dominant bacterial phylum during the SC peak over the
sampling period. Interestingly, changes in individual SC profiles are
significantly correlated with bacterial community temporal shifts (Fig. 4b).
Mannitol (<inline-formula><mml:math id="M204" display="inline"><mml:mrow><mml:msup><mml:mi>R</mml:mi><mml:mn mathvariant="normal">2</mml:mn></mml:msup><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.25</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M205" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula>), arabitol (<inline-formula><mml:math id="M206" display="inline"><mml:mrow><mml:msup><mml:mi>R</mml:mi><mml:mn mathvariant="normal">2</mml:mn></mml:msup><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.24</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M207" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula>), trehalose (<inline-formula><mml:math id="M208" display="inline"><mml:mrow><mml:msup><mml:mi>R</mml:mi><mml:mn mathvariant="normal">2</mml:mn></mml:msup><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.32</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M209" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula>), glucose
(<inline-formula><mml:math id="M210" display="inline"><mml:mrow><mml:msup><mml:mi>R</mml:mi><mml:mn mathvariant="normal">2</mml:mn></mml:msup><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.32</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M211" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula>), xylitol (<inline-formula><mml:math id="M212" display="inline"><mml:mrow><mml:msup><mml:mi>R</mml:mi><mml:mn mathvariant="normal">2</mml:mn></mml:msup><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.38</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M213" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula>), and erythritol (<inline-formula><mml:math id="M214" display="inline"><mml:mrow><mml:msup><mml:mi>R</mml:mi><mml:mn mathvariant="normal">2</mml:mn></mml:msup><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.27</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M215" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula>) are mainly
positively correlated to the bacterial community dissimilarity.</p>
      <p id="d1e3283">Given the distinct clustering patterns of airborne PM<inline-formula><mml:math id="M216" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> microbial beta
diversity structures according to SC concentration levels, a Pearson's rank
correlation analysis has been performed to further examine the relationship
between individual SC profiles and airborne microbial community abundance at
phylum and class levels. This analysis reveals that for class-level fungi,
the abundances of Dothideomycetes, Tremellomycetes, and Microbotryomycetes
are highly positively correlated (<inline-formula><mml:math id="M217" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.05</mml:mn></mml:mrow></mml:math></inline-formula>) to the temporal
evolutions of the individual SC species concentration levels (Fig. S5a).
Likewise, ambient SC species concentration levels are significantly
correlated (<inline-formula><mml:math id="M218" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.05</mml:mn></mml:mrow></mml:math></inline-formula>) to the Proteobacteria phylum (Fig. S5b). To
gain further insight into the airborne microbial fingerprints associated
with ambient SC species, correlation analyses were also performed at a finer
taxonomic level. These analyses show that the temporal dynamics of SC
species primarily correlates best (<inline-formula><mml:math id="M219" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.05</mml:mn></mml:mrow></mml:math></inline-formula>) with the
<italic>Cladosporium</italic>, <italic>Alternaria</italic>, <italic>Sporobolomyces</italic>, and <italic>Dioszegia</italic> fungal genera (Fig. 5a). Similarly, the time series of SC species
are primarily positively correlated (<inline-formula><mml:math id="M220" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.05</mml:mn></mml:mrow></mml:math></inline-formula>) with <italic>Massilia</italic>, <italic>Pseudomonas</italic>,
<italic>Frigoribacterium</italic>, and to a lesser degree (nonsignificant) with the <italic>Sphingomonas</italic> bacterial genus (Fig. 5b).</p>

      <?xmltex \floatpos{t}?><fig id="Ch1.F5" specific-use="star"><?xmltex \currentcnt{5}?><label>Figure 5</label><caption><p id="d1e3371">Heatmap of Spearman's rank correlation between SCs and abundance
of airborne communities at the study site. <bold>(a)</bold> Fungal genera and <bold>(b)</bold> bacterial
genera. Only genera with relative abundance <inline-formula><mml:math id="M221" display="inline"><mml:mrow><mml:mo>≥</mml:mo><mml:mn mathvariant="normal">1</mml:mn></mml:mrow></mml:math></inline-formula> are shown.</p></caption>
          <?xmltex \igopts{width=369.885827pt}?><graphic xlink:href="https://acp.copernicus.org/articles/20/5609/2020/acp-20-5609-2020-f05.png"/>

        </fig>

</sec>
<sec id="Ch1.S3.SS5">
  <label>3.5</label><title>Sources of airborne microbial communities at the study site</title>
      <?pagebreak page5618?><p id="d1e3405">As shown in Fig. 6, the airborne microbial genera most positively correlated
with SC species are also distributed in the surrounding environmental
samples of surface soils and leaves. In addition, microbial taxa of
PM<inline-formula><mml:math id="M222" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> associated with SC species are generally more abundant in the
leaf than in the topsoil samples (Fig. 6). In order to further explore and
visualize the similarity of species compositions across local environment
types, we conducted an NMDS ordination analysis (Fig. 7). As evidenced in
Fig. 7, the beta diversities of fungal and bacterial MOTUs are more similar
within the same habitat (PM<inline-formula><mml:math id="M223" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula>, plant, or soil) and are grouped across
habitats as expected. Interestingly, the beta diversities of fungal and
bacterial MOTUs in leaf samples and those in airborne PM<inline-formula><mml:math id="M224" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> are
generally not readily distinguishable, with similarity becoming more
prominent during atmospheric peaks of SC concentration levels (Fig. 6).
However, the overall beta diversities in airborne PM<inline-formula><mml:math id="M225" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> and in leaf
samples are significantly different from those from topsoil samples (ANOSIM,
<inline-formula><mml:math id="M226" display="inline"><mml:mrow><mml:mi>R</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.89</mml:mn></mml:mrow></mml:math></inline-formula> and 0.80 and <inline-formula><mml:math id="M227" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.01</mml:mn></mml:mrow></mml:math></inline-formula> for fungal and bacterial communities,
respectively), without any overlap regardless of whether or not harvesting
activities are performed around the sampling site.</p>

      <?xmltex \floatpos{t}?><fig id="Ch1.F6" specific-use="star"><?xmltex \currentcnt{6}?><label>Figure 6</label><caption><p id="d1e3471">Abundance of SC-species-associated microbial taxa. <bold>(a)</bold>  Fungal genera and
<bold>(b)</bold> bacterial genera in the airborne PM<inline-formula><mml:math id="M228" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> samples and surrounding
environmental samples. Black markers inside each box indicate the mean
abundance value, while the top, middle, and bottom lines of the box
represent the 75th, median, and 25th percentiles, respectively. The whiskers
at the top and bottom of the box extend from the 95th to the 5th percentiles.
Data were rarefied at the same minimum sequencing depth.</p></caption>
          <?xmltex \igopts{width=369.885827pt}?><graphic xlink:href="https://acp.copernicus.org/articles/20/5609/2020/acp-20-5609-2020-f06.png"/>

        </fig>

      <p id="d1e3495">This observation is also confirmed by an unsupervised hierarchical cluster
analysis, which reveals a pattern similar to that observed in the NMDS
ordination, where taxa from leaf samples and airborne PM<inline-formula><mml:math id="M229" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> are
clustered together regardless of whether ambient concentration levels of SC
peaked or not. They are clustered separately from those of topsoil
samples (Fig. S7).</p>

      <?xmltex \floatpos{t}?><fig id="Ch1.F7" specific-use="star"><?xmltex \currentcnt{7}?><label>Figure 7</label><caption><p id="d1e3510">Compositional comparison of sample types in a NMDS scaling
ordination. NMDS plots are constructed from a Horn distance matrix of MOTUs
abundances for fungi <bold>(a)</bold> and bacteria <bold>(b)</bold>. Data sets are
rarefied at the same sequencing depth. The stress values indicate an
adequate two-dimensional picture of sample distribution. Ellipses represent
95 % confidence intervals for the cluster centroids. Circular and
triangular shapes highlight air PM<inline-formula><mml:math id="M230" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> samples with
background and peak SC concentrations, respectively.</p></caption>
          <?xmltex \igopts{width=398.338583pt}?><graphic xlink:href="https://acp.copernicus.org/articles/20/5609/2020/acp-20-5609-2020-f07.png"/>

        </fig>

</sec>
</sec>
<sec id="Ch1.S4">
  <label>4</label><title>Discussion</title>
      <p id="d1e3543">Very few studies exist on the interactions between the air microbiome and PM
chemical profiles (Cao et al., 2014; Elbert et al.,
2007). In this study, we used a comprehensive multidisciplinary approach to
produce for the first time airborne microbial fingerprints associated with
SC species in PM<inline-formula><mml:math id="M231" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> and to identify the dominant sources of SCs in an extensively cultivated,
continental rural area.</p>
<?pagebreak page5619?><sec id="Ch1.S4.SS1">
  <label>4.1</label><?xmltex \opttitle{SCs as a major source of organic matter in PM${}_{{10}}$}?><title>SCs as a major source of organic matter in PM<inline-formula><mml:math id="M232" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula></title>
      <p id="d1e3571">SC species have recently been reported to be ubiquitous in PM<inline-formula><mml:math id="M233" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula>
collected in several areas in France
(Golly
et al., 2018; Samaké et al., 2019b). In this study, the total SCs
presented an average concentration of <inline-formula><mml:math id="M234" display="inline"><mml:mrow><mml:mn mathvariant="normal">259.8</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">253.8</mml:mn></mml:mrow></mml:math></inline-formula> ng m<inline-formula><mml:math id="M235" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">3</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula> with
a range of 26.6 to 1679.5 ng m<inline-formula><mml:math id="M236" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">3</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula> in all air samples. These
concentration values are on average 5 times higher than those typically
observed in urban areas in France (average values during summer <inline-formula><mml:math id="M237" display="inline"><mml:mrow><mml:mn mathvariant="normal">48.5</mml:mn><mml:mo>±</mml:mo><mml:mn mathvariant="normal">43.6</mml:mn></mml:mrow></mml:math></inline-formula> ng m<inline-formula><mml:math id="M238" display="inline"><mml:msup><mml:mi/><mml:mrow><mml:mo>-</mml:mo><mml:mn mathvariant="normal">3</mml:mn></mml:mrow></mml:msup></mml:math></inline-formula>)
(Golly
et al., 2018; Samaké et al., 2019a, b). However, these concentration
levels are in agreement with a previous study conducted in a similar
environment, i.e., continental rural sites located in large crop fields (Yan
et al., 2019).</p>
      <p id="d1e3644">The total concentrations of SCs quantified in atmospheric PM<inline-formula><mml:math id="M239" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> over
our study site accounted for 0.8 % to 13.5 % of the daily OM mass. This is
remarkable considering that less than 20 % of total particulate OM mass
can generally be identified at the molecular level. Hence, our results for a
9-week-long period indicate that SC could be a major identified molecular
fraction of OM for agricultural areas during summer, which is in agreement with
several previous studies conducted worldwide
(Jia et
al., 2010b; Verma et al., 2018; Yan et al., 2019). Further, it has been
shown (Samaké et al., 2019a) that the identified polyols probably
represent only a small fraction of the emission flux from this PBOA source
and that a large fraction of the co-emitted organic material remains
unknown. Hence, the PBOA source can potentially represent, for part of the
year, a major source of atmospheric OM unaccounted for in CTMs.</p>
</sec>
<sec id="Ch1.S4.SS2">
  <label>4.2</label><title>Composition of airborne fungal and bacterial communities</title>
      <p id="d1e3664">In this study, 597 (39–132 MOTUs per sample) and 944 (31–129 MOTUs per
sample) MOTUs were obtained for the fungal and bacterial libraries,
respectively, reflecting the high richness of airborne microbial communities
associated with ambient PM<inline-formula><mml:math id="M240" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> in this rural agricultural zone in France.
Airborne fungi were dominated by Ascomycota (AMC) followed by Basidiomycota
(BMC) phyla, consistent with the natural feature of many Ascomycota, whose
single-celled or hyphal forms are small enough to be rapidly aerosolized, in
contrast to many Basidiomycota that are typically too large<?pagebreak page5620?> to be easily
aerosolized (Moore et
al., 2011; Womack et al., 2015). Many members of AMC and BMC are known
to actively eject ascospores and basidiospores, as well as aqueous jets and
droplets containing a mixture of carbohydrates and inorganic solutes, into
the atmosphere (Elbert et
al., 2007; Womack et al., 2015). The prevalence of Ascomycota and
Basidiomycota is consistent with results from previous studies also
indicating that the Dikarya subkingdom (Ascomycota and Basidiomycota)
represents about 98 % of known species in the biological kingdom of
Eumycota (i.e., fungi) in the atmosphere (Elbert et al., 2007; James et al.,
2006; Womack et al., 2015; Xu et al., 2017).</p>
      <p id="d1e3676">Airborne bacteria in this study belonged mainly to the Proteobacteria,
Bacteroidetes, Actinobacteria, and Firmicutes phyla, consistent with previous
studies (Liu et al., 2019; Maron et al., 2005; Wei et al., 2019b).
Gram-negative<?pagebreak page5621?> Proteobacteria constitute a major taxonomic group among
prokaryotes
(Itävaara et al.,
2016; Yadav et al., 2018), including bacterial taxa which are very diverse,
important in agriculture, and capable of fixing nitrogen in symbiosis with
plants (Itävaara
et al., 2016; Yadav et al., 2018). Proteobacteria can survive under
conditions with very low nutrient content, which explains their atmospheric
versatility
(Itävaara et al.,
2016; Yadav et al., 2018). These results are similar to those observed in
previous studies conducted in different environments around the world, where
Proteobacteria, Actinobacteria, and Firmicutes have also been reported as
dominant bacterial phyla
(Liu
et al., 2019; Maron et al., 2005; Wei et al., 2019a). In particular, the
most frequent Gram-negative (Proteobacteria and Bacteroidetes) and
Gram-positive (Actinobacteria and Firmicutes) bacteria and filamentous
fungi (Ascomycota and Basidiomycota) have been previously linked to raw
straw handling activities. For instance, it has been suggested that straw
combustion during agricultural activities could be a major source of
airborne microorganisms in PM<inline-formula><mml:math id="M241" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">2.5</mml:mn></mml:msub></mml:math></inline-formula> in the northern plains of China
(Wei
et al., 2019a, b). However, in our study, SC species are not correlated
(<inline-formula><mml:math id="M242" display="inline"><mml:mrow><mml:mi>R</mml:mi><mml:mo>=</mml:mo><mml:mo>-</mml:mo><mml:mn mathvariant="normal">0.09</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M243" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.46</mml:mn></mml:mrow></mml:math></inline-formula>; Fig. S7) with levoglucosan during the campaign
period, confirming that biomass burning is not an important source of
airborne microbial taxa associated with SCs in our PM<inline-formula><mml:math id="M244" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> series. Bubble
bursting associated with sea spray could also potentially be a source of
bacteria, fungi, and water-soluble organic species, along with sea salts, to
PM<inline-formula><mml:math id="M245" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> (Prather et al., 2013; Zhu et al., 2015). However, SC species were
not found to be significantly related to <inline-formula><mml:math id="M246" display="inline"><mml:mrow class="chem"><mml:msup><mml:mi mathvariant="normal">Cl</mml:mi><mml:mo>-</mml:mo></mml:msup></mml:mrow></mml:math></inline-formula> (<inline-formula><mml:math id="M247" display="inline"><mml:mrow><mml:mi>R</mml:mi><mml:mo>=</mml:mo><mml:mo>-</mml:mo><mml:mn mathvariant="normal">0.14</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M248" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.28</mml:mn></mml:mrow></mml:math></inline-formula>) or <inline-formula><mml:math id="M249" display="inline"><mml:mrow class="chem"><mml:msup><mml:mi mathvariant="normal">Na</mml:mi><mml:mo>+</mml:mo></mml:msup></mml:mrow></mml:math></inline-formula> (<inline-formula><mml:math id="M250" display="inline"><mml:mrow><mml:mi>R</mml:mi><mml:mo>=</mml:mo><mml:mo>-</mml:mo><mml:mn mathvariant="normal">0.18</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M251" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.16</mml:mn></mml:mrow></mml:math></inline-formula>), which are two inorganic
tracers typical of marine sources, nor did they correlate with methanesulfonic acid
(<inline-formula><mml:math id="M252" display="inline"><mml:mrow><mml:mi>R</mml:mi><mml:mo>=</mml:mo><mml:mo>-</mml:mo><mml:mn mathvariant="normal">0.05</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M253" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.69</mml:mn></mml:mrow></mml:math></inline-formula>), a well-known tracer of biogenic marine activity
(Arndt et al., 2017; Gaston et al., 2010). It therefore seems unlikely that
the sources of SCs from marine environments were significant at this site.
This point is further discussed in Sect. 4.4.</p>
</sec>
<sec id="Ch1.S4.SS3">
  <label>4.3</label><?xmltex \opttitle{Atmospheric concentration levels of SC species in PM${}_{{10}}$ are associated
with the abundance of a few specific airborne taxa of fungi and bacteria}?><title>Atmospheric concentration levels of SC species in PM<inline-formula><mml:math id="M254" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> are associated
with the abundance of a few specific airborne taxa of fungi and bacteria</title>
      <p id="d1e3852">SCs are widely produced in large quantities by many microorganisms to cope
with environmental stress conditions
(Medeiros et al., 2006). SC
species are known to accumulate in high concentrations in microorganisms at
low water availability to reduce intracellular water activity and prevent
enzyme inhibition due to dehydration
(Hrynkiewicz et al.,
2010). In addition, the temporal dynamics of ambient polyol concentrations has
been suggested as an indicator to follow the general seasonal trend in
airborne fungal spore counts (Bauer et
al., 2008; Gosselin et al., 2016). Although this strategy has allowed the
introduction of conversion ratios between specific polyol species (i.e.,
arabitol and mannitol) and airborne fungal spores in general
(Bauer et al., 2008), the structure of the
airborne microbial community associated with SC species has not yet been
studied. Our results provide culture-independent evidence that the airborne
microbiome structure and the combined bacterial and fungal communities
largely determine the SC species concentration levels in PM<inline-formula><mml:math id="M255" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula>.</p>
      <p id="d1e3864">Temporal fluctuations in the abundance of only a few specific fungal and
bacterial genera reflect the temporal dynamics of ambient SC concentrations.
For fungi, genera that show a significant positive correlation (<inline-formula><mml:math id="M256" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.05</mml:mn></mml:mrow></mml:math></inline-formula>) with SC species include <italic>Cladosporium</italic>, <italic>Alternaria</italic>, <italic>Sporobolomyces</italic>, and <italic>Dioszegia</italic>. <italic>Cladosporium</italic> and <italic>Alternaria</italic> are fungal genera that
contribute on average to 47.9 % of total fungal sequence reads in our air
samples series. These are asexual fungal genera that produce spores by
dry-discharge mechanisms, wherein spores are detached from their parent
colonies and easily dispersed by the ambient airflow or other external
forces (e.g., raindrops, elevated temperature), as opposed to actively
discharged spores with liquid jets or droplets in the air
(Elbert
et al., 2007; Wei et al., 2019b; Womack et al., 2015). Our results are
consistent with the well-known seasonal behavior of airborne fungal spores
with levels of <italic>Cladosporium</italic> and <italic>Alternaria</italic> which have been shown to reach their maximum from early
to midsummer in a rural agricultural area of Portugal
(Oliveira et al., 2009).</p>
      <p id="d1e3904">Similarly, bacterial genera positively correlated with SC species are
<italic>Massilia</italic>, <italic>Pseudomonas</italic>, <italic>Frigoribacterium</italic>, and <italic>Sphingomonas</italic>. Although it is the prevalent bacterial genus at the study site,
<italic>Sphingomonas</italic> is indeed not significantly positively correlated with SC species. The
genus <italic>Sphingomonas</italic> is known to include numerous metabolically versatile species
capable of using carbon compounds usually present in the atmosphere
(Cáliz et al., 2018). The atmospheric
abundance of species affiliated with <italic>Massilia</italic> has already been linked to the change
in the stage of plant development (Ofek
et al., 2012), which can be attributed to the capacity of <italic>Massilia</italic> to promote plant
growth through the production of indoleacetic acid (Kuffner et al., 2010)
and siderophores (Hrynkiewizc et al., 2010), which makes it antagonistic towards <italic>Phytophthora infestans</italic> (Weinert et al., 2010).</p>
      <p id="d1e3936">As far as we know, this is the first study evaluating microbial fingerprints
with SC species in atmospheric PM; hence, it is not possible to compare our
correlation results with those of previous works. However, it has already
been suggested that types and quantities of SC species produced by fungi
under culture conditions are specific to microbial species and external
conditions such as carbon source, drought, heat, etc.
(Hrynkiewicz et al.,
2010). In future studies, we intend to apply a culture-dependent method to
directly characterize the SC contents of some species amongst the dominant
microbial taxa identified in this study after growth under several
laboratory chambers, reproducing controlled environmental conditions in terms
of temperature, water vapor, and carbon sources.</p>
</sec>
<?pagebreak page5622?><sec id="Ch1.S4.SS4">
  <label>4.4</label><?xmltex \opttitle{Local vegetation as a major source of airborne microbial taxa of PM${}_{{10}}$
associated with SC species}?><title>Local vegetation as a major source of airborne microbial taxa of PM<inline-formula><mml:math id="M257" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula>
associated with SC species</title>
      <p id="d1e3958">There are still many challenging questions on the emission processes leading
to fungi and bacteria being introduced into the atmosphere together with
their chemical components. In particular, the potential influence of soil
and vegetation and their respective roles in structuring airborne microbial
communities are still debated
(Lymperopoulou
et al., 2016; Rathnayake et al., 2016; Womack et al., 2015), especially
since this knowledge is particularly essential for the precise modeling of
PBOA emissions processes to the atmosphere within chemical transport models.</p>
      <p id="d1e3961">The characterization of the temporal dynamics of SC species concentrations could
provide important information on PBOA sources in terms of composition,
environmental drivers, and impacts. The results obtained over a 9-week period of daily PM<inline-formula><mml:math id="M258" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> SC measurements clearly show that the
temporal dynamics of sorbitol (<inline-formula><mml:math id="M259" display="inline"><mml:mrow><mml:mi>R</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.59</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M260" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.001</mml:mn></mml:mrow></mml:math></inline-formula>) and inositol
(<inline-formula><mml:math id="M261" display="inline"><mml:mrow><mml:mi>R</mml:mi><mml:mo>=</mml:mo><mml:mn mathvariant="normal">0.64</mml:mn></mml:mrow></mml:math></inline-formula>, <inline-formula><mml:math id="M262" display="inline"><mml:mrow><mml:mi>p</mml:mi><mml:mi mathvariant="italic">&lt;</mml:mi><mml:mn mathvariant="normal">0.001</mml:mn></mml:mrow></mml:math></inline-formula>) are well-correlated linearly with that of
calcium, a typical inorganic water-soluble ion from crustal material. This
indicates a common atmospheric origin for these chemicals. Sorbitol and
inositol are well-known reduced sugars that serve as a carbon source for
microorganisms when other carbon sources are limited
(Ng et
al., 2018; Xue et al., 2010). In microorganisms, sorbitol and inositol are
mainly produced by the reduction of intracellular glucose by aldose
reductase in the cytoplasm
(Ng
et al., 2018; Welsh, 2000; Xue et al., 2010). Moreover, significant
concentrations of both sorbitol and inositol have already been measured in
surface-soil samples from five cultivated fields in the San Joaquin Valley,
USA (Jia
et al., 2010b; Medeiros et al., 2006). Therefore, sorbitol and inositol are
most likely associated with microorganisms from soil resuspension.</p>
      <p id="d1e4021">With the exception of sorbitol and inositol, all other SC species measured
in air samples at our sampling site are strongly correlated with each other,
indicating a common origin. Daily calcium concentration peaks are not
systematically associated with those of these other SC species.
Interestingly, the highest atmospheric levels of these SC species occurred
on 8 August  2017, coinciding well with daily harvesting activities
around the site. This is also consistent with the multi-year monitoring of the
dominant SCs in PM<inline-formula><mml:math id="M263" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula>  at this site, where ambient SCs showed a clear
seasonal trend with higher values recorded in early August and in good
agreement with harvesting activities around the study area every year from
2012 to 2017 (Samaké et al.,
2019a). This suggests that the processes responsible for the dynamics of
atmospheric concentrations of SCs are replicated annually and are most likely
effective over large areas of field crop
(Golly
et al., 2018; Samaké et al., 2019a). Interestingly, glucose – the most
common monosaccharide present in vascular plants and microorganism – has
already been proposed as a molecular indicator of biota emitted into the
atmosphere by vascular plants and/or by the resuspension of soil from
agricultural land (Jia et al., 2010b;
Pietrogrande et al., 2014). Therefore, all other SC species measured in our
series can be considered to be most likely the result of the mechanical
resuspension of crop residues (e.g., leaf debris) and microorganisms
attached to them. Other confirmations of this interpretation stem from the
excellent daily covariations observed in the PM<inline-formula><mml:math id="M264" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> between SC species
levels and ambient cellulose, which is widely considered a reliable indicator of
plant debris sources in PM studies
(Bozzetti
et al., 2016; Hiranuma et al., 2019).</p>
      <p id="d1e4043">Microbial abundance and community structure in samples from the surrounding
environment can provide further useful information on source apportionment
and importance. Our data indicate that the airborne microbial genera most
positively correlated to SC species are also distributed in the surrounding
environmental samples of both surface soils and leaves, suggesting a
dominant influence of the local environment for microbial taxa associated
with SC species as opposed to long-range transport. This observation makes
sense since actively discharged ascospores and basidiospores are generally
relatively large airborne particles with a short atmospheric residence time
(Elbert et al., 2007;
Womack et al., 2015), limiting the possibilities of long-range
dissemination. Accordingly, the majority of previous studies investigating
the potential sources of air microbes identified local surface
environments (e.g., leaves, soils) as having more important effects on
the airborne microbiome structure in field crop areas
(Bowers
et al., 2011; Wei et al., 2019b; Womack et al., 2015). This is all the more
the case in our study with homogeneous crop activities for tens to hundreds of kilometers around the site.</p>
      <p id="d1e4046">In the present study, microbial diversity and richness observed in the
surface soils are generally higher than those on leaf surfaces. Microbial
taxa which most positively correlated with PM<inline-formula><mml:math id="M265" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> SC species are generally more
abundant in leaf than in topsoil samples. These results were unexpected and
show the possible importance of leaf surfaces in structuring the airborne
taxa associated with SC species. Considering the general grouping of leaf
samples and airborne PM<inline-formula><mml:math id="M266" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> regardless of harvesting activities around
the study site and in addition to the separate assemblies of rarefied MOTUs in
airborne PM<inline-formula><mml:math id="M267" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> and topsoil samples, it can be argued that the aerial parts
of plants are the major source of microbial taxa associated with SC species.
Such an observation is most likely related to increased vegetative surfaces
(e.g., leaves) in summer that provides sufficient nutrient resources for
microbial growth (Rathnayake et al.,
2016). By reviewing previous studies, <italic>Alternaria</italic> and <italic>Epicoccum</italic>, which made up 30 % of total
fungal sequence reads in all air samples in this study, have been shown to
be common saprobes or weak pathogens of leaf surfaces
(Andersen et al., 2009). Similarly,
<italic>Cladosporium</italic>, which accounted for 32.9 % of total fungal genera in all air samples,
has also been shown to be a common saprotrophic fungus, inhabiting decayed
tree or plant debris
(Wei
et al., 2019b). The high relative abundance of <italic>Sphingomonas<?pagebreak page5623?></italic> and <italic>Massilia</italic>, accounting for
28.4 % of total bacterial genera in all air samples, is also noticeable.
These two phyllosphere-inhabiting bacterial genera are well-known for their
plant protective potential against phytopathogens
(Aydogan et al., 2018; Rastogi et al.,
2013).</p>
      <p id="d1e4092">Altogether, these observations support our interpretation that leaves are
the major direct source of airborne fungi and bacteria during the summer
months at this site of high agricultural activity. Endophytes and
epiphytes can be dispersed in the air and transported vertically as
particles by air currents, much faster and more widely than by other
mechanisms, such as direct dissemination from surface soil, which is
generally controlled by soil moisture (Jocteur
Monrozier et al., 1993). The most wind-dispersible soil constituents are
indeed the smallest soil particles (i.e., clay-size fraction), which contain
the largest number of microorganisms (Jocteur
Monrozier et al., 1993) and can only be released into the atmosphere under
conditions of prolonged drought. This interpretation is also consistent with
previous studies
(Bowers
et al., 2011; Liu et al., 2019; Lymperopoulou et al., 2016; Mhuireach et
al., 2016), which also show the extent to which endophytes and epiphytes can
serve as quantitatively important sources of airborne microbes during
summertime when vegetation density is highest. For example,
Lymperopoulou et al. (2016) observed that
bacteria and fungi suspended in the air are generally 2 to more than 10
times more abundant in air that passed over 50 m of a vegetative surface than
in air that is immediately upwind of the same vegetative surface. However, the
relative abundance of taxa associated with SCs in surface soils in this
study could also be indicative of a feedback loop, in which the soil may
serve as a source of microbial endophytes and epiphytes for plants, while the
local vegetation in turn may serve as a source and sink of microbes for
local soils during leaf senescence.</p>
</sec>
</sec>
<sec id="Ch1.S5" sec-type="conclusions">
  <label>5</label><title>Conclusions</title>
      <p id="d1e4105">Primary biogenic organic aerosols (PBOAs) affect human health, climate,
agriculture, etc. However, the details of microbial communities associated
with the temporal and spatial variations in atmospheric concentrations of
SC, which are tracers of PBOAs, remain unknown. The present study aimed at identifying
the airborne fungi and bacteria associated with SC species in PM<inline-formula><mml:math id="M268" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> and
their major sources in the surrounding environment (soils and vegetation).
To that end, we combined high-throughput sequencing of bacteria and fungi
with detailed physicochemical characterizations of PM<inline-formula><mml:math id="M269" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> soil and leaf
samples collected at a continental rural background site located in a large
agricultural area in France.</p>
      <p id="d1e4126"><?xmltex \hack{\newpage}?>The main results demonstrate that the identified SC species are a major
contributor of OM in summer, accounting together for 0.8 % to 13.5 % of OM
mass in air. The atmospheric concentration peaks of SC coincide with the
daily harvest activities around the sampling site, pointing towards direct
resuspension of biological materials, i.e., crop residues and associated
microbiota as an important source of SC in our PM<inline-formula><mml:math id="M270" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> series.
Furthermore, we have also discovered that the temporal evolutions of SC in
PM<inline-formula><mml:math id="M271" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> are associated with the abundance of only a few specific airborne
fungal and bacterial taxa. These microbial taxa are significantly enhanced in
the surrounding environmental samples of leaves over surface soils. Finally,
the excellent correlation of SC species and cellulose, a marker of plant
materials, implies that local vegetation is likely the most important source
of fungal and bacterial taxa associated with SC in PM<inline-formula><mml:math id="M272" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> at rural
locations directly influenced by agricultural activities in France.</p>
      <p id="d1e4157">Our findings are a first step in the understanding of the processes leading to
the emission of these important chemical species and the large OM fraction of PM
in the atmosphere, and in the parametrization of these processes for their
introduction in CTMs. They could also be used for planning efforts to
reduce both the PBOA source strengths and the spreading of airborne
microbial and derivative allergens such as endotoxins and mycotoxins.
However, it remains to be investigated how well different climate patterns and
sampling site specificities, in terms of land use and vegetation cover,
could affect our main conclusions.</p>
</sec>

      
      </body>
    <back><notes notes-type="dataavailability"><title>Data availability</title>

      <p id="d1e4164">The sequencing data files are
available from the DRYAD repository (<ext-link xlink:href="https://doi.org/10.5061/dryad.2fqz612m4" ext-link-type="DOI">10.5061/dryad.2fqz612m4</ext-link>, Samaké et al., 2020). All
relevant chemical and environmental data sets are archived at the IGE
(Institut des Géosciences de l'Environnement) and are available upon
request from the co-author (Jean-Luc Jaffrezo).</p>
  </notes><app-group>
        <supplementary-material position="anchor"><p id="d1e4170">The supplement related to this article is available online at: <inline-supplementary-material xlink:href="https://doi.org/10.5194/acp-20-5609-2020-supplement" xlink:title="pdf">https://doi.org/10.5194/acp-20-5609-2020-supplement</inline-supplementary-material>.</p></supplementary-material>
        </app-group><notes notes-type="authorcontribution"><title>Author contributions</title>

      <p id="d1e4179">JLJ, JMFM, and GU supervised the thesis
of AS, and JLJ, JMFM, GU, and AS designed the research project.
PT gave advice for soil and leaf sampling. SC supervised the sample
collections and provided the agricultural activity records. VJ developed
the analytical techniques for SC species and cellulose measurements. AS
and AB performed the experiments. AB performed the bioinformatic
analyses. AS performed statistical analyses and wrote the original
draft. SW produced the circular phylogenetic trees. All authors
reviewed and edited the final paper.</p>
  </notes><notes notes-type="competinginterests"><title>Competing interests</title>

      <p id="d1e4185">The authors declare that they have no conflict of interest.</p>
  </notes><ack><title>Acknowledgements</title><p id="d1e4191">We acknowledge the work of many engineers in the
lab at the Institut des Géosciences de l'Environnement for the analyses
(Anthony Vella, Vincent Lucaire). The authors would like to kindly thank the
dedicated efforts of many other people at the sampling site and in the
laboratories for collecting and analyzing the samples.</p><p id="d1e4193">The PhD of Abdoulaye Samaké is funded by the
government of Mali. We gratefully acknowledge the LEFE-CHAT and EC2CO
programs of the CNRS for financial supports of the CAREMBIOS
multidisciplinary project, with ADEME funding. Chemical and microbiological
analytical aspects were supported at IGE by the Air-O-Sol and MOME
platforms, respectively, within Labex OSUG@2020 (ANR10 LABX56).</p></ack><notes notes-type="reviewstatement"><title>Review statement</title>

      <p id="d1e4198">This paper was edited by Alex Huffman and reviewed by two anonymous referees.</p>
  </notes><ref-list>
    <title>References</title>

      <ref id="bib1.bib1"><label>1</label><?label 1?><mixed-citation>Amato, P., Brisebois, E., Draghi, M., Duchaine, C., Fröhlich-Nowoisky,
J., Huffman, J. A., Mainelis, G., Robine, E., and Thibaudon, M.: Main
biological aerosols, specificities, abundance, and diversity, in
Microbiology of Aerosols, pp. 1–21, John Wiley &amp; Sons, Ltd.,
<ext-link xlink:href="https://doi.org/10.1002/9781119132318" ext-link-type="DOI">10.1002/9781119132318</ext-link>, 2017.</mixed-citation></ref>
      <ref id="bib1.bib2"><label>2</label><?label 1?><mixed-citation>Andersen, G. L., Frisch, A. S., Kellogg, C. A., Levetin, E., Lighthart, B.,
and Paterno, D.: Aeromicrobiology/air quality, in Encyclopedia of
Microbiology (Third Edition), pp. 11–26, Academic Press, Oxford., <ext-link xlink:href="https://doi.org/10.1016/B978-012373944-5.00166-8" ext-link-type="DOI">10.1016/B978-012373944-5.00166-8</ext-link>, 2009.</mixed-citation></ref>
      <ref id="bib1.bib3"><label>3</label><?label 1?><mixed-citation>Arndt, J., Sciare, J., Mallet, M., Roberts, G. C., Marchand, N., Sartelet, K., Sellegri, K., Dulac, F., Healy, R. M., and Wenger, J. C.: Sources and mixing state of summertime background aerosol in the north-western Mediterranean basin, Atmos. Chem. Phys., 17, 6975–7001, <ext-link xlink:href="https://doi.org/10.5194/acp-17-6975-2017" ext-link-type="DOI">10.5194/acp-17-6975-2017</ext-link>, 2017.</mixed-citation></ref>
      <ref id="bib1.bib4"><label>4</label><?label 1?><mixed-citation>Aydogan, E. L., Moser, G., Müller, C., Kämpfer, P., and Glaeser, S.
P.: Long-term warming shifts the composition of bacterial communities in the
phyllosphere of galium album in a permanent grassland field-experiment,
Front. Microbiol., 9, 144, <ext-link xlink:href="https://doi.org/10.3389/fmicb.2018.00144" ext-link-type="DOI">10.3389/fmicb.2018.00144</ext-link>, 2018.</mixed-citation></ref>
      <ref id="bib1.bib5"><label>5</label><?label 1?><mixed-citation>Barbaro, E., Kirchgeorg, T., Zangrando, R., Vecchiato, M., Piazza, R.,
Barbante, C., and Gambaro, A.: Sugars in Antarctic aerosol, Atmos. Environ.,
118, 135–144, <ext-link xlink:href="https://doi.org/10.1016/j.atmosenv.2015.07.047" ext-link-type="DOI">10.1016/j.atmosenv.2015.07.047</ext-link>, 2015.</mixed-citation></ref>
      <ref id="bib1.bib6"><label>6</label><?label 1?><mixed-citation>Bauer, H., Claeys, M., Vermeylen, R., Schueller, E., Weinke, G., Berger, A.,
and Puxbaum, H.: Arabitol and mannitol as tracers for the quantification of
airborne fungal spores, Atmos. Environ., 42, 588–593,
<ext-link xlink:href="https://doi.org/10.1016/j.atmosenv.2007.10.013" ext-link-type="DOI">10.1016/j.atmosenv.2007.10.013</ext-link>, 2008.</mixed-citation></ref>
      <ref id="bib1.bib7"><label>7</label><?label 1?><mixed-citation>Boucher, O., Randall, D., Artaxo, P., Bretherton, C., Feingold, G., Forster,
P., Kerminen, V.-M., Kondo, Y., Liao, H., and Lohmann, U.: Clouds and
aerosols, in: Climate change 2013: the physical science basis, Contribution
of Working Group I to the Fifth Assessment Report of the Intergovernmental
Panel on Climate Change,  571–657, Cambridge University Press,
<ext-link xlink:href="https://doi.org/10.1017/CBO9781107415324.016" ext-link-type="DOI">10.1017/CBO9781107415324.016</ext-link>, 2013.</mixed-citation></ref>
      <ref id="bib1.bib8"><label>8</label><?label 1?><mixed-citation>Bougouffa, S., Radovanovic, A., Essack, M., and Bajic, V. B.: DEOP: a
database on osmoprotectants and associated pathways, Database, 2014,
<ext-link xlink:href="https://doi.org/10.1093/database/bau100" ext-link-type="DOI">10.1093/database/bau100</ext-link>, 2014.</mixed-citation></ref>
      <ref id="bib1.bib9"><label>9</label><?label 1?><mixed-citation>Bowers, R. M., Sullivan, A. P., Costello, E. K., Collett, J. L., Knight, R.,
and Fiereri, N.: Sources of bacteria in outdoor air across cities in the
Midwestern United States, Appl. Environ. Microbiol., 77, 6350–6356,
<ext-link xlink:href="https://doi.org/10.1128/AEM.05498-11" ext-link-type="DOI">10.1128/AEM.05498-11</ext-link>, 2011.</mixed-citation></ref>
      <ref id="bib1.bib10"><label>10</label><?label 1?><mixed-citation>Boyer, F., Mercier, C., Bonin, A., Le Bras, Y., Taberlet, P., and Coissac,
E.: OBITOOLS: a UNIX-inspired software package for DNA metabarcoding, Mol.
Ecol. Resour., 16, 176–182, <ext-link xlink:href="https://doi.org/10.1111/1755-0998.12428" ext-link-type="DOI">10.1111/1755-0998.12428</ext-link>, 2016.</mixed-citation></ref>
      <ref id="bib1.bib11"><label>11</label><?label 1?><mixed-citation>Bozzetti, C., Daellenbach, K. R., Hueglin, C., Fermo, P., Sciare, J.,
Kasper-Giebl, A., Mazar, Y., Abbaszade, G., El Kazzi, M., Gonzalez, R.,
Shuster-Meiseles, T., Flasch, M., Wolf, R., Křepelová, A., Canonaco,
F., Schnelle-Kreis, J., Slowik, J. G., Zimmermann, R., Rudich, Y.,
Baltensperger, U., El Haddad, I., and Prévôt, A. S. H.:
Size-resolved identification, characterization, and quantification of
primary biological organic aerosol at a European rural site, Environ. Sci.
Technol., 50, 3425–3434, <ext-link xlink:href="https://doi.org/10.1021/acs.est.5b05960" ext-link-type="DOI">10.1021/acs.est.5b05960</ext-link>, 2016.</mixed-citation></ref>
      <ref id="bib1.bib12"><label>12</label><?label 1?><mixed-citation>Cáliz, J., Triadó-Margarit, X., Camarero, L., and Casamayor, E. O.:
A long-term survey unveils strong seasonal patterns in the airborne
microbiome coupled to general and regional atmospheric circulations, P.
Natl. Acad. Sci., 115, 12229, <ext-link xlink:href="https://doi.org/10.1073/pnas.1812826115" ext-link-type="DOI">10.1073/pnas.1812826115</ext-link>, 2018.</mixed-citation></ref>
      <ref id="bib1.bib13"><label>13</label><?label 1?><mixed-citation>Cao, C., Jiang, W., Wang, B., Fang, J., Lang, J., Tian, G., Jiang, J., and
Zhu, T. F.: Inhalable microorganisms in Beijing's PM<inline-formula><mml:math id="M273" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">2.5</mml:mn></mml:msub></mml:math></inline-formula> and PM<inline-formula><mml:math id="M274" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula>
pollutants during a severe smog event, Environ. Sci. Technol., 48,
1499–1507, <ext-link xlink:href="https://doi.org/10.1021/es4048472" ext-link-type="DOI">10.1021/es4048472</ext-link>, 2014.</mixed-citation></ref>
      <ref id="bib1.bib14"><label>14</label><?label 1?><mixed-citation>Cavalli, F., Viana, M., Yttri, K. E., Genberg, J., and Putaud, J.-P.: Toward a standardised thermal-optical protocol for measuring atmospheric organic and elemental carbon: the EUSAAR protocol, Atmos. Meas. Tech., 3, 79–89, <ext-link xlink:href="https://doi.org/10.5194/amt-3-79-2010" ext-link-type="DOI">10.5194/amt-3-79-2010</ext-link>, 2010.</mixed-citation></ref>
      <ref id="bib1.bib15"><label>15</label><?label 1?><mixed-citation>China, S., Burrows, S. M., Wang, B., Harder, T. H., Weis, J., Tanarhte, M.,
Rizzo, L. V., Brito, J., Cirino, G. G., Ma, P.-L., Cliff, J., Artaxo, P.,
Gilles, M. K., and Laskin, A.: Fungal spores as a source of sodium salt
particles in the Amazon basin, Nat. Commun., 9, 4793,
<ext-link xlink:href="https://doi.org/10.1038/s41467-018-07066-4" ext-link-type="DOI">10.1038/s41467-018-07066-4</ext-link>, 2018.</mixed-citation></ref>
      <ref id="bib1.bib16"><label>16</label><?label 1?><mixed-citation>Ciarelli, G., Aksoyoglu, S., Crippa, M., Jimenez, J.-L., Nemitz, E., Sellegri, K., Äijälä, M., Carbone, S., Mohr, C., O'Dowd, C., Poulain, L., Baltensperger, U., and Prévôt, A. S. H.: Evaluation of European air quality modelled by CAMx including the volatility basis set scheme, Atmos. Chem. Phys., 16, 10313–10332, <ext-link xlink:href="https://doi.org/10.5194/acp-16-10313-2016" ext-link-type="DOI">10.5194/acp-16-10313-2016</ext-link>, 2016.</mixed-citation></ref>
      <ref id="bib1.bib17"><label>17</label><?label 1?><mixed-citation>Coz, E., Artíñano, B., Clark, L. M., Hernandez, M., Robinson, A.
L., Casuccio, G. S., Lersch, T. L., and Pandis, S. N.: Characterization of
fine primary biogenic organic aerosol in an urban area in the northeastern
United States, Atmos. Environ., 44, 3952–3962,
<ext-link xlink:href="https://doi.org/10.1016/j.atmosenv.2010.07.007" ext-link-type="DOI">10.1016/j.atmosenv.2010.07.007</ext-link>, 2010.</mixed-citation></ref>
      <ref id="bib1.bib18"><label>18</label><?label 1?><mixed-citation>Dommergue, A., Amato, P., Tignat-Perrier, R., Magand, O., Thollot, A., Joly,
M., Bouvier, L., Sellegri, K., Vogel, T., Sonke, J. E., Jaffrezo, J.-L.,
Andrade, M., Moreno, I., Labuschagne, C., Martin, L., Zhang, Q., and Larose,
C.: Methods to investigate the global atmospheric microbiome, Front.
Microbiol., 10, 243, <ext-link xlink:href="https://doi.org/10.3389/fmicb.2019.00243" ext-link-type="DOI">10.3389/fmicb.2019.00243</ext-link>, 2019.</mixed-citation></ref>
      <ref id="bib1.bib19"><label>19</label><?label 1?><mixed-citation>Elbert, W., Taylor, P. E., Andreae, M. O., and Pöschl, U.: Contribution of fungi to primary biogenic aerosols in the atmosphere: we<?pagebreak page5625?>t and dry discharged spores, carbohydrates, and inorganic ions, Atmos. Chem. Phys., 7, 4569–4588, <ext-link xlink:href="https://doi.org/10.5194/acp-7-4569-2007" ext-link-type="DOI">10.5194/acp-7-4569-2007</ext-link>, 2007.</mixed-citation></ref>
      <ref id="bib1.bib20"><label>20</label><?label 1?><mixed-citation>Ficetola, G., Coissac, E., Zundel, S., Riaz, T., Shehzad, W., Bessière,
J., Taberlet, P., and Pompanon, F.: An in silico approach for the evaluation
of DNA barcodes, BMC Genomics, 11, 434, <ext-link xlink:href="https://doi.org/10.1186/1471-2164-11-434" ext-link-type="DOI">10.1186/1471-2164-11-434</ext-link>,
2010.</mixed-citation></ref>
      <ref id="bib1.bib21"><label>21</label><?label 1?><mixed-citation>Fröhlich-Nowoisky, J., Kampf, C. J., Weber, B., Huffman, J. A.,
Pöhlker, C., Andreae, M. O., Lang-Yona, N., Burrows, S. M., Gunthe, S.
S., Elbert, W., Su, H., Hoor, P., Thines, E., Hoffmann, T., Després, V.
R., and Pöschl, U.: Bioaerosols in the earth system: climate, health,
and ecosystem interactions, Atmos. Res., 182, 346–376,
<ext-link xlink:href="https://doi.org/10.1016/j.atmosres.2016.07.018" ext-link-type="DOI">10.1016/j.atmosres.2016.07.018</ext-link>, 2016.</mixed-citation></ref>
      <ref id="bib1.bib22"><label>22</label><?label 1?><mixed-citation>Fu, P., Kawamura, K., Kobayashi, M., and Simoneit, B. R.: Seasonal
variations of sugars in atmospheric particulate matter from Gosan, Jeju
Island: Significant contributions of airborne pollen and Asian dust in
spring, Atmos. Environ., 55, 234–239, <ext-link xlink:href="https://doi.org/10.1029/2003JD003697" ext-link-type="DOI">10.1029/2003JD003697</ext-link>, 2012.</mixed-citation></ref>
      <ref id="bib1.bib23"><label>23</label><?label 1?><mixed-citation>Fuzzi, S., Andreae, M. O., Huebert, B. J., Kulmala, M., Bond, T. C., Boy, M., Doherty, S. J., Guenther, A., Kanakidou, M., Kawamura, K., Kerminen, V.-M., Lohmann, U., Russell, L. M., and Pöschl, U.: Critical assessment of the current state of scientific knowledge, terminology, and research needs concerning the role of organic aerosols in the atmosphere, climate, and global change, Atmos. Chem. Phys., 6, 2017–2038, <ext-link xlink:href="https://doi.org/10.5194/acp-6-2017-2006" ext-link-type="DOI">10.5194/acp-6-2017-2006</ext-link>, 2006.</mixed-citation></ref>
      <ref id="bib1.bib24"><label>24</label><?label 1?><mixed-citation>Fuzzi, S., Baltensperger, U., Carslaw, K., Decesari, S., Denier van der Gon, H., Facchini, M. C., Fowler, D., Koren, I., Langford, B., Lohmann, U., Nemitz, E., Pandis, S., Riipinen, I., Rudich, Y., Schaap, M., Slowik, J. G., Spracklen, D. V., Vignati, E., Wild, M., Williams, M., and Gilardoni, S.: Particulate matter, air quality and climate: lessons learned and future needs, Atmos. Chem. Phys., 15, 8217–8299, <ext-link xlink:href="https://doi.org/10.5194/acp-15-8217-2015" ext-link-type="DOI">10.5194/acp-15-8217-2015</ext-link>, 2015.</mixed-citation></ref>
      <ref id="bib1.bib25"><label>25</label><?label 1?><mixed-citation>Gaston, C. J., Pratt, K. A., Qin, X., and Prather, K. A.: Real-time
detection and mixing state of methanesulfonate in single particles at an
inland urban location during a phytoplankton bloom, Environ. Sci. Technol.,
44, 1566–1572, <ext-link xlink:href="https://doi.org/10.1021/es902069d" ext-link-type="DOI">10.1021/es902069d</ext-link>, 2010.</mixed-citation></ref>
      <ref id="bib1.bib26"><label>26</label><?label 1?><mixed-citation>Golly, B., Waked, A., Weber, S., Samaké, A., Jacob, V., Conil, S.,
Rangognio, J., Chrétien, E., Vagnot, M.-P., Robic, P.-Y., Besombes,
J.-L., and Jaffrezo, J.-L.: Organic markers and OC source apportionment for
seasonal variations of PM<inline-formula><mml:math id="M275" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">2.5</mml:mn></mml:msub></mml:math></inline-formula> at 5 rural sites in France, Atmos.
Environ., 198, 142–157, <ext-link xlink:href="https://doi.org/10.1016/j.atmosenv.2018.10.027" ext-link-type="DOI">10.1016/j.atmosenv.2018.10.027</ext-link>, 2018.</mixed-citation></ref>
      <ref id="bib1.bib27"><label>27</label><?label 1?><mixed-citation>Gosselin, M. I., Rathnayake, C. M., Crawford, I., Pöhlker, C., Fröhlich-Nowoisky, J., Schmer, B., Després, V. R., Engling, G., Gallagher, M., Stone, E., Pöschl, U., and Huffman, J. A.: Fluorescent bioaerosol particle, molecular tracer, and fungal spore concentrations during dry and rainy periods in a semi-arid forest, Atmos. Chem. Phys., 16, 15165–15184, <ext-link xlink:href="https://doi.org/10.5194/acp-16-15165-2016" ext-link-type="DOI">10.5194/acp-16-15165-2016</ext-link>, 2016.</mixed-citation></ref>
      <ref id="bib1.bib28"><label>28</label><?label 1?><mixed-citation>Heald, C. L., Coe, H., Jimenez, J. L., Weber, R. J., Bahreini, R., Middlebrook, A. M., Russell, L. M., Jolleys, M., Fu, T.-M., Allan, J. D., Bower, K. N., Capes, G., Crosier, J., Morgan, W. T., Robinson, N. H., Williams, P. I., Cubison, M. J., DeCarlo, P. F., and Dunlea, E. J.: Exploring the vertical profile of atmospheric organic aerosol: comparing 17 aircraft field campaigns with a global model, Atmos. Chem. Phys., 11, 12673–12696, <ext-link xlink:href="https://doi.org/10.5194/acp-11-12673-2011" ext-link-type="DOI">10.5194/acp-11-12673-2011</ext-link>, 2011.</mixed-citation></ref>
      <ref id="bib1.bib29"><label>29</label><?label 1?><mixed-citation>Hill, T. C. J., DeMott, P. J., Conen, F., and Möhler, O.: Impacts of
bioaerosols on atmospheric ice nucleation Processes, in Microbiology of
Aerosols, pp. 195–219, John Wiley &amp; Sons, Ltd.,
<ext-link xlink:href="https://doi.org/10.1002/9781119132318" ext-link-type="DOI">10.1002/9781119132318</ext-link>, 2017.</mixed-citation></ref>
      <ref id="bib1.bib30"><label>30</label><?label 1?><mixed-citation>Hiranuma, N., Adachi, K., Bell, D. M., Belosi, F., Beydoun, H., Bhaduri, B., Bingemer, H., Budke, C., Clemen, H.-C., Conen, F., Cory, K. M., Curtius, J., DeMott, P. J., Eppers, O., Grawe, S., Hartmann, S., Hoffmann, N., Höhler, K., Jantsch, E., Kiselev, A., Koop, T., Kulkarni, G., Mayer, A., Murakami, M., Murray, B. J., Nicosia, A., Petters, M. D., Piazza, M., Polen, M., Reicher, N., Rudich, Y., Saito, A., Santachiara, G., Schiebel, T., Schill, G. P., Schneider, J., Segev, L., Stopelli, E., Sullivan, R. C., Suski, K., Szakáll, M., Tajiri, T., Taylor, H., Tobo, Y., Ullrich, R., Weber, D., Wex, H., Whale, T. F., Whiteside, C. L., Yamashita, K., Zelenyuk, A., and Möhler, O.: A comprehensive characterization of ice nucleation by three different types of cellulose particles immersed in water, Atmos. Chem. Phys., 19, 4823–4849, <ext-link xlink:href="https://doi.org/10.5194/acp-19-4823-2019" ext-link-type="DOI">10.5194/acp-19-4823-2019</ext-link>, 2019.</mixed-citation></ref>
      <ref id="bib1.bib31"><label>31</label><?label 1?><mixed-citation>Hrynkiewicz, K., Baum, C., and Leinweber, P.: Density, metabolic activity,
and identity of cultivable rhizosphere bacteria on Salix viminalis in
disturbed arable and landfill soils, J. Plant Nutr. Soil Sci., 173,
747–756, <ext-link xlink:href="https://doi.org/10.1002/jpln.200900286" ext-link-type="DOI">10.1002/jpln.200900286</ext-link>, 2010.</mixed-citation></ref>
      <ref id="bib1.bib32"><label>32</label><?label 1?><mixed-citation>Hsieh, T. C., Ma, K. H., and Chao, A.: iNEXT: an R package for rarefaction
and extrapolation of species diversity (Hill numbers), Methods Ecol. Evol.,
7, 1451–1456, <ext-link xlink:href="https://doi.org/10.1111/2041-210X.12613" ext-link-type="DOI">10.1111/2041-210X.12613</ext-link>, 2016.</mixed-citation></ref>
      <ref id="bib1.bib33"><label>33</label><?label 1?><mixed-citation>Huerta-Cepas, J., Serra, F., and Bork, P.: ETE 3: Reconstruction, analysis,
and visualization of Phylogenomic Data, Mol. Biol. Evol., 33, 1635–1638,
<ext-link xlink:href="https://doi.org/10.1093/molbev/msw046" ext-link-type="DOI">10.1093/molbev/msw046</ext-link>, 2016.</mixed-citation></ref>
      <ref id="bib1.bib34"><label>34</label><?label 1?><mixed-citation>Huffman, J. A. and Santarpia, J.: Online techniques for quantification and
characterization of biological aerosols, in Microbiology of Aerosols, pp.
83–114, John Wiley &amp; Sons, Ltd., <ext-link xlink:href="https://doi.org/10.1002/9781119132318" ext-link-type="DOI">10.1002/9781119132318</ext-link>,
2017.</mixed-citation></ref>
      <ref id="bib1.bib35"><label>35</label><?label 1?><mixed-citation>Huffman, J. A., Perring, A. E., Savage, N. J., Clot, B., Crouzy, B., Tummon,
F., Shoshanim, O., Damit, B., Schneider, J., Sivaprakasam, V., Zawadowicz,
M. A., Crawford, I., Gallagher, M., Topping, D., Doughty, D. C., Hill, S.
C., and Pan, Y.: Real-time sensing of bioaerosols: review and current
perspectives, Aerosol Sci. Technol., 54, 465–495,
<ext-link xlink:href="https://doi.org/10.1080/02786826.2019.1664724" ext-link-type="DOI">10.1080/02786826.2019.1664724</ext-link>, 2019.</mixed-citation></ref>
      <ref id="bib1.bib36"><label>36</label><?label 1?><mixed-citation>Itävaara, M., Salavirta, H., Marjamaa, K., and Ruskeeniemi, T.:
Geomicrobiology and metagenomics of Terrestrial Deep Subsurface Microbiomes,
Adv. Appl. Microbiol., 94, 1–77,
<ext-link xlink:href="https://doi.org/10.1016/bs.aambs.2015.12.001" ext-link-type="DOI">10.1016/bs.aambs.2015.12.001</ext-link>, 2016.</mixed-citation></ref>
      <ref id="bib1.bib37"><label>37</label><?label 1?><mixed-citation>James, T. Y., Kauff, F., Schoch, C. L., Matheny, P. B., Hofstetter, V., Cox,
C. J., Celio, G., Gueidan, C., Fraker, E., Miadlikowska, J., Lumbsch, H. T.,
Rauhut, A., Reeb, V., Arnold, A. E., Amtoft, A., Stajich, J. E., Hosaka, K.,
Sung, G.-H., Johnson, D., O'Rourke, B., Crockett, M., Binder, M., Curtis, J.
M., Slot, J. C., Wang, Z., Wilson, A. W., Schüßler, A., Longcore, J.
E., O'Donnell, K., Mozley-Standridge, S., Porter, D., Letcher, P. M.,
Powell, M. J., Taylor, J. W., White, M. M., Griffith, G. W., Davies, D. R.,
Humber, R. A., Morton, J. B., Sugiyama, J., Rossman, A. Y., Rogers, J. D.,
Pfister, D. H., Hewitt, D., Hansen, K., Hambleton, S., Shoemaker, R. A.,
Kohlmeyer, J., Volkmann-Kohlmeyer, B.<?pagebreak page5626?>, Spotts, R. A., Serdani, M., Crous, P.
W., Hughes, K. W., Matsuura, K., Langer, E., Langer, G., Untereiner, W. A.,
Lücking, R., Büdel, B., Geiser, D. M., Aptroot, A., Diederich, P.,
Schmitt, I., Schultz, M., Yahr, R., Hibbett, D. S., Lutzoni, F., McLaughlin,
D. J., Spatafora, J. W., and Vilgalys, R.: Reconstructing the early
evolution of Fungi using a six-gene phylogeny, Nature, 443, 818–822,
<ext-link xlink:href="https://doi.org/10.1038/nature05110" ext-link-type="DOI">10.1038/nature05110</ext-link>, 2006.</mixed-citation></ref>
      <ref id="bib1.bib38"><label>38</label><?label 1?><mixed-citation>Jia, Y., Bhat, S., and Fraser, M. P.: Characterization of saccharides and
other organic compounds in fine particles and the use of saccharides to
track primary biologically derived carbon sources, Atmos. Environ., 44,
724–732, <ext-link xlink:href="https://doi.org/10.1016/j.atmosenv.2009.10.034" ext-link-type="DOI">10.1016/j.atmosenv.2009.10.034</ext-link>, 2010a.</mixed-citation></ref>
      <ref id="bib1.bib39"><label>39</label><?label 1?><mixed-citation>Jia, Y., Clements, A. L., and Fraser, M. P.: Saccharide composition in
atmospheric particulate matter in the southwest US and estimates of source
contributions, J. Aerosol Sci., 41, 62–73,
<ext-link xlink:href="https://doi.org/10.1016/j.jaerosci.2009.08.005" ext-link-type="DOI">10.1016/j.jaerosci.2009.08.005</ext-link>, 2010b.</mixed-citation></ref>
      <ref id="bib1.bib40"><label>40</label><?label 1?><mixed-citation>Jiang, W., Liang, P., Wang, B., Fang, J., Lang, J., Tian, G., Jiang, J., and
Zhu, T. F.: Optimized DNA extraction and metagenomic sequencing of airborne
microbial communities, Nat. Protoc., 10, 768–779,
<ext-link xlink:href="https://doi.org/10.1038/nprot.2015.046" ext-link-type="DOI">10.1038/nprot.2015.046</ext-link>, 2015.</mixed-citation></ref>
      <ref id="bib1.bib41"><label>41</label><?label 1?><mixed-citation>Jocteur Monrozier, L., Guez, P., Chalamet, A., Bardin, R., Martins, J., and
Gaudet, J. P.: Distribution of microorganisms and fate of xenobiotic
molecules in unsaturated soil environments, Sci. Total Environ., 136,
121–133, <ext-link xlink:href="https://doi.org/10.1016/0048-9697(93)90302-M" ext-link-type="DOI">10.1016/0048-9697(93)90302-M</ext-link>, 1993.</mixed-citation></ref>
      <ref id="bib1.bib42"><label>42</label><?label 1?><mixed-citation>Kang, M., Ren, L., Ren, H., Zhao, Y., Kawamura, K., Zhang, H., Wei, L., Sun,
Y., Wang, Z., and Fu, P.: Primary biogenic and anthropogenic sources of
organic aerosols in Beijing, China: insights from saccharides and n-alkanes,
Environ. Pollut., 243, 1579–1587, <ext-link xlink:href="https://doi.org/10.1016/j.envpol.2018.09.118" ext-link-type="DOI">10.1016/j.envpol.2018.09.118</ext-link>, 2018.</mixed-citation></ref>
      <ref id="bib1.bib43"><label>43</label><?label 1?><mixed-citation>Kelly, F. J. and Fussell, J. C.: Air pollution and public health: emerging
hazards and improved understanding of risk, Environ. Geochem. Health, 37,
631–649, <ext-link xlink:href="https://doi.org/10.1007/s10653-015-9720-1" ext-link-type="DOI">10.1007/s10653-015-9720-1</ext-link>, 2015.</mixed-citation></ref>
      <ref id="bib1.bib44"><label>44</label><?label 1?><mixed-citation>Kuffner, M., De Maria, S., Puschenreiter, M., Fallmann, K., Wieshammer, G.,
Gorfer, M., Strauss, J., Rivelli, A. R., and Sessitsch, A.: Culturable
bacteria from Zn- and Cd-accumulating Salix caprea with differential effects
on plant growth and heavy metal availability, J. Appl. Microbiol., 108,
1471–1484, <ext-link xlink:href="https://doi.org/10.1111/j.1365-2672.2010.04670.x" ext-link-type="DOI">10.1111/j.1365-2672.2010.04670.x</ext-link>, 2010.</mixed-citation></ref>
      <ref id="bib1.bib45"><label>45</label><?label 1?><mixed-citation>Liu, H., Hu, Z., Zhou, M., Hu, J., Yao, X., Zhang, H., Li, Z., Lou, L., Xi,
C., Qian, H., Li, C., Xu, X., Zheng, P., and Hu, B.: The distribution
variance of airborne microorganisms in urban and rural environments,
Environ. Pollut., 247, 898–906, <ext-link xlink:href="https://doi.org/10.1016/j.envpol.2019.01.090" ext-link-type="DOI">10.1016/j.envpol.2019.01.090</ext-link>, 2019.</mixed-citation></ref>
      <ref id="bib1.bib46"><label>46</label><?label 1?><mixed-citation>Luhung, I., Wu, Y., Ng, C. K., Miller, D., Cao, B., and Chang, V. W.-C.:
Protocol improvements for low concentration DNA-based bioaerosol sampling
and analysis, PLOS ONE, 10, e0141158, <ext-link xlink:href="https://doi.org/10.1371/journal.pone.0141158" ext-link-type="DOI">10.1371/journal.pone.0141158</ext-link>,
2015.</mixed-citation></ref>
      <ref id="bib1.bib47"><label>47</label><?label 1?><mixed-citation>Lymperopoulou, D. S., Adams, R. I., and Lindow, S. E.: Contribution of
vegetation to the microbial composition of nearby outdoor air, Appl.
Environ. Microbiol., 82, 3822–3833, <ext-link xlink:href="https://doi.org/10.1128/AEM.00610-16" ext-link-type="DOI">10.1128/AEM.00610-16</ext-link>, 2016.</mixed-citation></ref>
      <ref id="bib1.bib48"><label>48</label><?label 1?><mixed-citation>Maron, P.-A., Lejon, D. P. H., Carvalho, E., Bizet, K., Lemanceau, P.,
Ranjard, L., and Mougel, C.: Assessing genetic structure and diversity of
airborne bacterial communities by DNA fingerprinting and 16S rDNA clone
library, Atmos. Environ., 39, 3687–3695,
<ext-link xlink:href="https://doi.org/10.1016/j.atmosenv.2005.03.002" ext-link-type="DOI">10.1016/j.atmosenv.2005.03.002</ext-link>, 2005.</mixed-citation></ref>
      <ref id="bib1.bib49"><label>49</label><?label 1?><mixed-citation>McMurdie, P. J. and Holmes, S.: phyloseq: An R package for reproducible
interactive analysis and graphics of microbiome sensus Data, PLoS ONE, 8,
e61217, <ext-link xlink:href="https://doi.org/10.1371/journal.pone.0061217" ext-link-type="DOI">10.1371/journal.pone.0061217</ext-link>, 2013.</mixed-citation></ref>
      <ref id="bib1.bib50"><label>50</label><?label 1?><mixed-citation>Medeiros, P. M., Conte, M. H., Weber, J. C., and Simoneit, B. R. T.: Sugars
as source indicators of biogenic organic carbon in aerosols collected above
the howland experimental forest, Maine, Atmos. Environ., 40, 1694–1705,
<ext-link xlink:href="https://doi.org/10.1016/j.atmosenv.2005.11.001" ext-link-type="DOI">10.1016/j.atmosenv.2005.11.001</ext-link>, 2006.
 </mixed-citation></ref>
      <ref id="bib1.bib51"><label>51</label><?label 1?><mixed-citation>
Mercier, C., Boyer, F., Kopylova, E., Taberlet, P., Bonin, A., and Coissac,
E.: SUMATRA and SUMACLUST: fast and exact comparison and clustering of
sequences. Programs and Abstracts of the SeqBio, Workshop, pp. 27–29,
2013.</mixed-citation></ref>
      <ref id="bib1.bib52"><label>52</label><?label 1?><mixed-citation>Mhuireach, G., Johnson, B. R., Altrichter, A. E., Ladau, J., Meadow, J. F.,
Pollard, K. S., and Green, J. L.: Urban greenness influences airborne
bacterial community composition, Sci. Total Environ., 571, 680–687,
<ext-link xlink:href="https://doi.org/10.1016/j.scitotenv.2016.07.037" ext-link-type="DOI">10.1016/j.scitotenv.2016.07.037</ext-link>, 2016.</mixed-citation></ref>
      <ref id="bib1.bib53"><label>53</label><?label 1?><mixed-citation>Moore, D., Robson, G. D., and Trinci, A. P. J.: 21st century guidebook to
fungi, Cambridge University Press, Cambridge,
<ext-link xlink:href="https://doi.org/10.1017/CBO9780511977022" ext-link-type="DOI">10.1017/CBO9780511977022</ext-link>, 2011.</mixed-citation></ref>
      <ref id="bib1.bib54"><label>54</label><?label 1?><mixed-citation>Ng, T. W., Ip, M., Chao, C. Y. H., Tang, J. W., Lai, K. P., Fu, S. C.,
Leung, W. T., and Lai, K. M.: Differential gene expression in Escherichia
coli during aerosolization from liquid suspension, Appl. Microbiol.
Biotechnol., 102, 6257–6267, <ext-link xlink:href="https://doi.org/10.1007/s00253-018-9083-5" ext-link-type="DOI">10.1007/s00253-018-9083-5</ext-link>, 2018.</mixed-citation></ref>
      <ref id="bib1.bib55"><label>55</label><?label 1?><mixed-citation>Ofek, M., Hadar, Y., and Minz, D.: Ecology of root colonizing massilia
(oxalobacteraceae), PLoS ONE, 7, e40117,
<ext-link xlink:href="https://doi.org/10.1371/journal.pone.0040117" ext-link-type="DOI">10.1371/journal.pone.0040117</ext-link>, 2012.</mixed-citation></ref>
      <ref id="bib1.bib56"><label>56</label><?label 1?><mixed-citation>Oksanen, J., Blanchet, F. G., Friendly, M., Kindt, R., Legendre, P.,
McGlinn, D., R. Minchin, P. R., O'Hara, R. B., Simpson, G. L., Solymos,
Peter, Stevens, M. H. H., Szoecs, E., and Wagner, H.: Vegan: community
ecology package, available at: <uri>https://cran.r-project.org</uri> (last access: 7 May 2020) and
<uri>https://github.com/vegandevs/vegan</uri> (last access: 7 May 2020), 2019.</mixed-citation></ref>
      <ref id="bib1.bib57"><label>57</label><?label 1?><mixed-citation>Oliveira, M., Ribeiro, H., Delgado, J. L., and Abreu, I.: The effects of
meteorological factors on airborne fungal spore concentration in two areas
differing in urbanisation level, Int. J. Biometeorol., 53, 61–73,
<ext-link xlink:href="https://doi.org/10.1007/s00484-008-0191-2" ext-link-type="DOI">10.1007/s00484-008-0191-2</ext-link>, 2009.</mixed-citation></ref>
      <ref id="bib1.bib58"><label>58</label><?label 1?><mixed-citation>Prather, K. A., Bertram, T. H., Grassian, V. H., Deane, G. B., Stokes, M.
D., DeMott, P. J., Aluwihare, L. I., Palenik, B. P., Azam, F., Seinfeld, J.
H., Moffet, R. C., Molina, M. J., Cappa, C. D., Geiger, F. M., Roberts, G.
C., Russell, L. M., Ault, A. P., Baltrusaitis, J., Collins, D. B., Corrigan,
C. E., Cuadra-Rodriguez, L. A., Ebben, C. J., Forestieri, S. D., Guasco, T.
L., Hersey, S. P., Kim, M. J., Lambert, W. F., Modini, R. L., Mui, W.,
Pedler, B. E., Ruppel, M. J., Ryder, O. S., Schoepp, N. G., Sullivan, R. C.,
and Zhao, D.: Bringing the ocean into the laboratory to probe the chemical
complexity of sea spray aerosol, P. Natl. Acad. Sci. USA, 110,
7550–7555, <ext-link xlink:href="https://doi.org/10.1073/pnas.1300262110" ext-link-type="DOI">10.1073/pnas.1300262110</ext-link>, 2013.</mixed-citation></ref>
      <ref id="bib1.bib59"><label>59</label><?label 1?><mixed-citation>Pietrogrande, M. C., Bacco, D., Visentin, M., Ferrari, S., and Casali, P.:
Polar organic marker compounds in atmospheric aerosol in the Po valley
during the Supersito campaigns – part 2: seasonal variations of sugars,
Atmos. Environ., 97, 215–225, <ext-link xlink:href="https://doi.org/10.1016/j.atmosenv.2014.07.056" ext-link-type="DOI">10.1016/j.atmosenv.2014.07.056</ext-link>, 2014.</mixed-citation></ref>
      <ref id="bib1.bib60"><label>60</label><?label 1?><mixed-citation>
Pope, C. A. and Dockery, D. W.: Health effects of fine particulate air
pollution: lines that connect, J. Air Waste Manag. Assoc., 56, 709–742,
2006.</mixed-citation></ref>
      <?pagebreak page5627?><ref id="bib1.bib61"><label>61</label><?label 1?><mixed-citation>Rastogi, G., Coaker, G. L., and Leveau, J. H. J.: New insights into the
structure and function of phyllosphere microbiota through high-throughput
molecular approaches, FEMS Microbiol. Lett., 348, 1–10,
<ext-link xlink:href="https://doi.org/10.1111/1574-6968.12225" ext-link-type="DOI">10.1111/1574-6968.12225</ext-link>, 2013.</mixed-citation></ref>
      <ref id="bib1.bib62"><label>62</label><?label 1?><mixed-citation>Rathnayake, C. M., Metwali, N., Baker, Z., Jayarathne, T., Kostle, P. A.,
Thorne, P. S., O'Shaughnessy, P. T., and Stone, E. A.: Urban enhancement of
PM<inline-formula><mml:math id="M276" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> bioaerosol tracers relative to background locations in the
midwestern United States, J. Geophys. Res.-Atmos., 121, 5071–5089,
<ext-link xlink:href="https://doi.org/10.1002/2015JD024538" ext-link-type="DOI">10.1002/2015JD024538</ext-link>, 2016.</mixed-citation></ref>
      <ref id="bib1.bib63"><label>63</label><?label 1?><mixed-citation>Samaké, A., Uzu, G., Martins, J. M. F., Calas, A., Vince, E., Parat, S.,
and Jaffrezo, J. L.: The unexpected role of bioaerosols in the Oxidative
Potential of PM, Sci. Rep., 7, 10978, <ext-link xlink:href="https://doi.org/10.1038/s41598-017-11178-0" ext-link-type="DOI">10.1038/s41598-017-11178-0</ext-link>, 2017.</mixed-citation></ref>
      <ref id="bib1.bib64"><label>64</label><?label 1?><mixed-citation>Samaké, A., Jaffrezo, J.-L., Favez, O., Weber, S., Jacob, V., Canete, T., Albinet, A., Charron, A., Riffault, V., Perdrix, E., Waked, A., Golly, B., Salameh, D., Chevrier, F., Oliveira, D. M., Besombes, J.-L., Martins, J. M. F., Bonnaire, N., Conil, S., Guillaud, G., Mesbah, B., Rocq, B., Robic, P.-Y., Hulin, A., Le Meur, S., Descheemaecker, M., Chretien, E., Marchand, N., and Uzu, G.: Arabitol, mannitol, and glucose as tracers of primary biogenic organic aerosol: the influence of environmental factors on ambient air concentrations and spatial distribution over France, Atmos. Chem. Phys., 19, 11013–11030, <ext-link xlink:href="https://doi.org/10.5194/acp-19-11013-2019" ext-link-type="DOI">10.5194/acp-19-11013-2019</ext-link>, 2019a.</mixed-citation></ref>
      <ref id="bib1.bib65"><label>65</label><?label 1?><mixed-citation>Samaké, A., Jaffrezo, J.-L., Favez, O., Weber, S., Jacob, V., Albinet, A., Riffault, V., Perdrix, E., Waked, A., Golly, B., Salameh, D., Chevrier, F., Oliveira, D. M., Bonnaire, N., Besombes, J.-L., Martins, J. M. F., Conil, S., Guillaud, G., Mesbah, B., Rocq, B., Robic, P.-Y., Hulin, A., Le Meur, S., Descheemaecker, M., Chretien, E., Marchand, N., and Uzu, G.: Polyols and glucose particulate species as tracers of primary biogenic organic aerosols at 28 French sites, Atmos. Chem. Phys., 19, 3357–3374, <ext-link xlink:href="https://doi.org/10.5194/acp-19-3357-2019" ext-link-type="DOI">10.5194/acp-19-3357-2019</ext-link>, 2019b.</mixed-citation></ref>
      <ref id="bib1.bib66"><label>66</label><?label 1?><mixed-citation>Samaké, A., Bonin, A., Jaffrezo, J.-L., Taberlet, P., Weber, S., Uzu, G., Jacob, V., Conil, S., and Martins, J. M. F.: Sequencing data from: High levels of primary biogenic organic aerosols are
driven by only a few plant-associated microbial taxa, v2, Dryad, Dataset, <ext-link xlink:href="https://doi.org/10.5061/dryad.2fqz612m4" ext-link-type="DOI">10.5061/dryad.2fqz612m4</ext-link>, 2020.</mixed-citation></ref>
      <ref id="bib1.bib67"><label>67</label><?label 1?><mixed-citation>Schnell, I. B., Bohmann, K., and Gilbert, M. T. P.: Tag jumps illuminated –
reducing sequence-to-sample misidentifications in metabarcoding studies,
Mol. Ecol. Resour., 15, 1289–1303, <ext-link xlink:href="https://doi.org/10.1111/1755-0998.12402" ext-link-type="DOI">10.1111/1755-0998.12402</ext-link>, 2015.</mixed-citation></ref>
      <ref id="bib1.bib68"><label>68</label><?label 1?><mixed-citation>Taberlet, P., Bonin, A., Zinger, L., and Coissac, E.: Environmental DNA: for
biodiversity research and monitoring, Oxford University Press, Oxford, New
York, <ext-link xlink:href="https://doi.org/10.1093/oso/9780198767220.001.0001" ext-link-type="DOI">10.1093/oso/9780198767220.001.0001</ext-link>, 2018.</mixed-citation></ref>
      <ref id="bib1.bib69"><label>69</label><?label 1?><mixed-citation>Verma, S. K., Kawamura, K., Chen, J., and Fu, P.: Thirteen years of observations on primary sugars and sugar alcohols over remote Chichijima Island in the western North Pacific, Atmos. Chem. Phys., 18, 81–101, <ext-link xlink:href="https://doi.org/10.5194/acp-18-81-2018" ext-link-type="DOI">10.5194/acp-18-81-2018</ext-link>, 2018.</mixed-citation></ref>
      <ref id="bib1.bib70"><label>70</label><?label 1?><mixed-citation>Waked, A., Favez, O., Alleman, L. Y., Piot, C., Petit, J.-E., Delaunay, T., Verlinden, E., Golly, B., Besombes, J.-L., Jaffrezo, J.-L., and Leoz-Garziandia, E.: Source apportionment of PM<inline-formula><mml:math id="M277" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">10</mml:mn></mml:msub></mml:math></inline-formula> in a north-western Europe regional urban background site (Lens, France) using positive matrix factorization and including primary biogenic emissions, Atmos. Chem. Phys., 14, 3325–3346, <ext-link xlink:href="https://doi.org/10.5194/acp-14-3325-2014" ext-link-type="DOI">10.5194/acp-14-3325-2014</ext-link>, 2014.</mixed-citation></ref>
      <ref id="bib1.bib71"><label>71</label><?label 1?><mixed-citation>Weber, S., Uzu, G., Calas, A., Chevrier, F., Besombes, J.-L., Charron, A., Salameh, D., Ježek, I., Močnik, G., and Jaffrezo, J.-L.: An apportionment method for the oxidative potential of atmospheric particulate matter sources: application to a one-year study in Chamonix, France, Atmos. Chem. Phys., 18, 9617–9629, <ext-link xlink:href="https://doi.org/10.5194/acp-18-9617-2018" ext-link-type="DOI">10.5194/acp-18-9617-2018</ext-link>, 2018.</mixed-citation></ref>
      <ref id="bib1.bib72"><label>72</label><?label 1?><mixed-citation>Wei, M., Xu, C., Xu, X., Zhu, C., Li, J., and Lv, G.: Characteristics of
atmospheric bacterial and fungal communities in PM<inline-formula><mml:math id="M278" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">2.5</mml:mn></mml:msub></mml:math></inline-formula> following biomass
burning disturbance in a rural area of North China Plain, Sci. Total
Environ., 651, 2727–2739, <ext-link xlink:href="https://doi.org/10.1016/j.scitotenv.2018.09.399" ext-link-type="DOI">10.1016/j.scitotenv.2018.09.399</ext-link>, 2019a.</mixed-citation></ref>
      <ref id="bib1.bib73"><label>73</label><?label 1?><mixed-citation>Wei, M., Xu, C., Xu, X., Zhu, C., Li, J., and Lv, G.: Size distribution of
bioaerosols from biomass burning emissions: characteristics of bacterial and
fungal communities in submicron (PM<inline-formula><mml:math id="M279" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">1.0</mml:mn></mml:msub></mml:math></inline-formula>) and fine (PM<inline-formula><mml:math id="M280" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">2.5</mml:mn></mml:msub></mml:math></inline-formula>)
particles, Ecotoxicol. Environ. Saf., 171, 37–46,
<ext-link xlink:href="https://doi.org/10.1016/j.ecoenv.2018.12.026" ext-link-type="DOI">10.1016/j.ecoenv.2018.12.026</ext-link>, 2019b.</mixed-citation></ref>
      <ref id="bib1.bib74"><label>74</label><?label 1?><mixed-citation>Weinert, N., Meincke, R., Gottwald, C., Radl, V., Dong, X., Schloter, M.,
Berg, G., and Smalla, K.: Effects of genetically modified potatoes with
increased zeaxanthin content on the abundance and diversity of rhizobacteria
with in vitro antagonistic activity do not exceed natural variability among
cultivars, Plant Soil, 326, 437–452, <ext-link xlink:href="https://doi.org/10.1007/s11104-009-0024-z" ext-link-type="DOI">10.1007/s11104-009-0024-z</ext-link>,
2010.</mixed-citation></ref>
      <ref id="bib1.bib75"><label>75</label><?label 1?><mixed-citation>Welsh, D. T.: Ecological significance of compatible solute accumulation by
micro-organisms: from single cells to global climate, FEMS Microbiol. Rev.,
24, 263–290, <ext-link xlink:href="https://doi.org/10.1111/j.1574-6976.2000.tb00542.x" ext-link-type="DOI">10.1111/j.1574-6976.2000.tb00542.x</ext-link>, 2000.</mixed-citation></ref>
      <ref id="bib1.bib76"><label>76</label><?label 1?><mixed-citation>Womack, A. M., Artaxo, P. E., Ishida, F. Y., Mueller, R. C., Saleska, S. R., Wiedemann, K. T., Bohannan, B. J. M., and Green, J. L.: Characterization of active and total fungal communities in the atmosphere over the Amazon rainforest, Biogeosciences, 12, 6337–6349, <ext-link xlink:href="https://doi.org/10.5194/bg-12-6337-2015" ext-link-type="DOI">10.5194/bg-12-6337-2015</ext-link>, 2015.</mixed-citation></ref>
      <ref id="bib1.bib77"><label>77</label><?label 1?><mixed-citation>Xu, C., Wei, M., Chen, J., Zhu, C., Li, J., Lv, G., Xu, X., Zheng, L., Sui, G., Li, W., Chen, B., Wang, W., Zhang, Q., Ding, A., and Mellouki, A.: Fungi diversity in PM<inline-formula><mml:math id="M281" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">2.5</mml:mn></mml:msub></mml:math></inline-formula> and PM<inline-formula><mml:math id="M282" display="inline"><mml:msub><mml:mi/><mml:mn mathvariant="normal">1</mml:mn></mml:msub></mml:math></inline-formula> at the summit of Mt. Tai: abundance, size distribution, and seasonal variation, Atmos. Chem. Phys., 17, 11247–11260, <ext-link xlink:href="https://doi.org/10.5194/acp-17-11247-2017" ext-link-type="DOI">10.5194/acp-17-11247-2017</ext-link>, 2017.</mixed-citation></ref>
      <ref id="bib1.bib78"><label>78</label><?label 1?><mixed-citation>Xue, C., Liu, T., Chen, L., Li, W., Liu, I., Kronstad, J. W., Seyfang, A.
and Heitman, J.: Role of an expanded inositol transporter repertoire in
cryptococcus neoformans sexual reproduction and virulence, 1, e00084-10,
<ext-link xlink:href="https://doi.org/10.1128/mBio.00084-10" ext-link-type="DOI">10.1128/mBio.00084-10</ext-link>, 2010.</mixed-citation></ref>
      <ref id="bib1.bib79"><label>79</label><?label 1?><mixed-citation>Yadav, A. N., Verma, P., Sachan, S. G., Kaushik, R., and Saxena, A. K.:
Psychrotrophic microbiomes: molecular diversity and beneficial role in plant
growth promotion and soil health, in Microorganisms for Green Revolution,
vol. 7, pp. 197–240, Springer Singapore, Singapore, <ext-link xlink:href="https://doi.org/10.1007/978-981-10-7146-1_11" ext-link-type="DOI">10.1007/978-981-10-7146-1_11</ext-link>, 2018.</mixed-citation></ref>
      <ref id="bib1.bib80"><label>80</label><?label 1?><mixed-citation>Yan, C., Sullivan, A. P., Cheng, Y., Zheng, M., Zhang, Y., Zhu, T., and
Collett, J. L.: Characterization of saccharides and associated usage in
determining biogenic and biomass burning aerosols in atmospheric fine
particulate matter in the North China Plain, Sci. Total Environ., 650,
2939–2950, <ext-link xlink:href="https://doi.org/10.1016/j.scitotenv.2018.09.325" ext-link-type="DOI">10.1016/j.scitotenv.2018.09.325</ext-link>, 2019.</mixed-citation></ref>
      <ref id="bib1.bib81"><label>81</label><?label 1?><mixed-citation>
Yang, Y., Chan, C., Tao, J., Lin, M., Engling, G., Zhang, Z., Zhang, T., and
Su, L.: Observation of elevated fungal tracers due to biomass burning in the
Sichuan Basin at Chengdu City, China, Sci. Total Environ., 431, 68–77,
2012.</mixed-citation></ref>
      <?pagebreak page5628?><ref id="bib1.bib82"><label>82</label><?label 1?><mixed-citation>Yu, X., Wang, Z., Zhang, M., Kuhn, U., Xie, Z., Cheng, Y., Pöschl, U., and Su, H.: Ambient measurement of fluorescent aerosol particles with a WIBS in the Yangtze River Delta of China: potential impacts of combustion-related aerosol particles, Atmos. Chem. Phys., 16, 11337–11348, <ext-link xlink:href="https://doi.org/10.5194/acp-16-11337-2016" ext-link-type="DOI">10.5194/acp-16-11337-2016</ext-link>, 2016.
</mixed-citation></ref><?xmltex \hack{\newpage}?>
      <ref id="bib1.bib83"><label>83</label><?label 1?><mixed-citation>
Zhu, C., Kawamura, K., and Kunwar, B.: Organic tracers of primary biological
aerosol particles at subtropical Okinawa Island in the western North Pacific
Rim: organic biomarkers in the north pacific, J. Geophys.
Res.-Atmos., 120, 5504–5523, 2015.</mixed-citation></ref>

  </ref-list></back>
    <!--<article-title-html>High levels of primary biogenic organic aerosols are driven by only a few plant-associated microbial taxa</article-title-html>
<abstract-html><p>Primary biogenic organic aerosols (PBOAs) represent a
major fraction of coarse organic matter (OM) in air. Despite their
implication in many atmospheric processes and human health problems, we
surprisingly know little about PBOA characteristics (i.e., composition,
dominant sources, and contribution to airborne particles). In addition,
specific primary sugar compounds (SCs) are generally used as markers of PBOAs
associated with bacteria and fungi, but our knowledge of microbial
communities associated with atmospheric particulate matter (PM) remains
incomplete. This work aimed at providing a comprehensive understanding of
the microbial fingerprints associated with SCs in PM<sub>10</sub> (particles
smaller than 10&thinsp;µm) and their main sources in the surrounding
environment (soils and vegetation). An intensive study was conducted on
PM<sub>10</sub> collected at a rural background site located in an agricultural area
in France. We combined high-throughput sequencing of bacteria and fungi with
detailed physicochemical characterizations of PM<sub>10</sub>, soil, and plant
samples and monitored meteorological and agricultural activities throughout
the sampling period. Results show that in summer SCs in PM<sub>10</sub> are a
major contributor of OM in air, representing 0.8&thinsp;% to 13.5&thinsp;% of OM mass. SC
concentrations are clearly determined by the abundance of only a few
specific airborne fungal and bacterial taxa. The temporal fluctuations in the
abundance of only four predominant fungal genera, namely <i>Cladosporium</i>, <i>Alternaria</i>,
<i>Sporobolomyces</i>, and <i>Dioszegia</i>, reflect the
temporal dynamics in SC concentrations. Among bacterial taxa, the abundance
of only <i>Massilia</i>, <i>Pseudomonas</i>, <i>Frigoribacterium</i>, and <i>Sphingomonas</i>
is positively correlated with SC species. These
microbes
are significantly enhanced in leaf over soil samples. Interestingly, the
overall community structure of bacteria and fungi are similar within
PM<sub>10</sub> and leaf samples and significantly distinct between PM<sub>10</sub> and
soil samples, indicating that surrounding vegetation is the major source of
SC-associated microbial taxa in PM<sub>10</sub> in this rural area of France.</p></abstract-html>
<ref-html id="bib1.bib1"><label>1</label><mixed-citation>
Amato, P., Brisebois, E., Draghi, M., Duchaine, C., Fröhlich-Nowoisky,
J., Huffman, J. A., Mainelis, G., Robine, E., and Thibaudon, M.: Main
biological aerosols, specificities, abundance, and diversity, in
Microbiology of Aerosols, pp. 1–21, John Wiley &amp; Sons, Ltd.,
<a href="https://doi.org/10.1002/9781119132318" target="_blank">https://doi.org/10.1002/9781119132318</a>, 2017.
</mixed-citation></ref-html>
<ref-html id="bib1.bib2"><label>2</label><mixed-citation>
Andersen, G. L., Frisch, A. S., Kellogg, C. A., Levetin, E., Lighthart, B.,
and Paterno, D.: Aeromicrobiology/air quality, in Encyclopedia of
Microbiology (Third Edition), pp. 11–26, Academic Press, Oxford., <a href="https://doi.org/10.1016/B978-012373944-5.00166-8" target="_blank">https://doi.org/10.1016/B978-012373944-5.00166-8</a>, 2009.
</mixed-citation></ref-html>
<ref-html id="bib1.bib3"><label>3</label><mixed-citation>
Arndt, J., Sciare, J., Mallet, M., Roberts, G. C., Marchand, N., Sartelet, K., Sellegri, K., Dulac, F., Healy, R. M., and Wenger, J. C.: Sources and mixing state of summertime background aerosol in the north-western Mediterranean basin, Atmos. Chem. Phys., 17, 6975–7001, <a href="https://doi.org/10.5194/acp-17-6975-2017" target="_blank">https://doi.org/10.5194/acp-17-6975-2017</a>, 2017.
</mixed-citation></ref-html>
<ref-html id="bib1.bib4"><label>4</label><mixed-citation>
Aydogan, E. L., Moser, G., Müller, C., Kämpfer, P., and Glaeser, S.
P.: Long-term warming shifts the composition of bacterial communities in the
phyllosphere of galium album in a permanent grassland field-experiment,
Front. Microbiol., 9, 144, <a href="https://doi.org/10.3389/fmicb.2018.00144" target="_blank">https://doi.org/10.3389/fmicb.2018.00144</a>, 2018.
</mixed-citation></ref-html>
<ref-html id="bib1.bib5"><label>5</label><mixed-citation>
Barbaro, E., Kirchgeorg, T., Zangrando, R., Vecchiato, M., Piazza, R.,
Barbante, C., and Gambaro, A.: Sugars in Antarctic aerosol, Atmos. Environ.,
118, 135–144, <a href="https://doi.org/10.1016/j.atmosenv.2015.07.047" target="_blank">https://doi.org/10.1016/j.atmosenv.2015.07.047</a>, 2015.
</mixed-citation></ref-html>
<ref-html id="bib1.bib6"><label>6</label><mixed-citation>
Bauer, H., Claeys, M., Vermeylen, R., Schueller, E., Weinke, G., Berger, A.,
and Puxbaum, H.: Arabitol and mannitol as tracers for the quantification of
airborne fungal spores, Atmos. Environ., 42, 588–593,
<a href="https://doi.org/10.1016/j.atmosenv.2007.10.013" target="_blank">https://doi.org/10.1016/j.atmosenv.2007.10.013</a>, 2008.
</mixed-citation></ref-html>
<ref-html id="bib1.bib7"><label>7</label><mixed-citation>
Boucher, O., Randall, D., Artaxo, P., Bretherton, C., Feingold, G., Forster,
P., Kerminen, V.-M., Kondo, Y., Liao, H., and Lohmann, U.: Clouds and
aerosols, in: Climate change 2013: the physical science basis, Contribution
of Working Group I to the Fifth Assessment Report of the Intergovernmental
Panel on Climate Change,  571–657, Cambridge University Press,
<a href="https://doi.org/10.1017/CBO9781107415324.016" target="_blank">https://doi.org/10.1017/CBO9781107415324.016</a>, 2013.
</mixed-citation></ref-html>
<ref-html id="bib1.bib8"><label>8</label><mixed-citation>
Bougouffa, S., Radovanovic, A., Essack, M., and Bajic, V. B.: DEOP: a
database on osmoprotectants and associated pathways, Database, 2014,
<a href="https://doi.org/10.1093/database/bau100" target="_blank">https://doi.org/10.1093/database/bau100</a>, 2014.
</mixed-citation></ref-html>
<ref-html id="bib1.bib9"><label>9</label><mixed-citation>
Bowers, R. M., Sullivan, A. P., Costello, E. K., Collett, J. L., Knight, R.,
and Fiereri, N.: Sources of bacteria in outdoor air across cities in the
Midwestern United States, Appl. Environ. Microbiol., 77, 6350–6356,
<a href="https://doi.org/10.1128/AEM.05498-11" target="_blank">https://doi.org/10.1128/AEM.05498-11</a>, 2011.
</mixed-citation></ref-html>
<ref-html id="bib1.bib10"><label>10</label><mixed-citation>
Boyer, F., Mercier, C., Bonin, A., Le Bras, Y., Taberlet, P., and Coissac,
E.: OBITOOLS: a UNIX-inspired software package for DNA metabarcoding, Mol.
Ecol. Resour., 16, 176–182, <a href="https://doi.org/10.1111/1755-0998.12428" target="_blank">https://doi.org/10.1111/1755-0998.12428</a>, 2016.
</mixed-citation></ref-html>
<ref-html id="bib1.bib11"><label>11</label><mixed-citation>
Bozzetti, C., Daellenbach, K. R., Hueglin, C., Fermo, P., Sciare, J.,
Kasper-Giebl, A., Mazar, Y., Abbaszade, G., El Kazzi, M., Gonzalez, R.,
Shuster-Meiseles, T., Flasch, M., Wolf, R., Křepelová, A., Canonaco,
F., Schnelle-Kreis, J., Slowik, J. G., Zimmermann, R., Rudich, Y.,
Baltensperger, U., El Haddad, I., and Prévôt, A. S. H.:
Size-resolved identification, characterization, and quantification of
primary biological organic aerosol at a European rural site, Environ. Sci.
Technol., 50, 3425–3434, <a href="https://doi.org/10.1021/acs.est.5b05960" target="_blank">https://doi.org/10.1021/acs.est.5b05960</a>, 2016.
</mixed-citation></ref-html>
<ref-html id="bib1.bib12"><label>12</label><mixed-citation>
Cáliz, J., Triadó-Margarit, X., Camarero, L., and Casamayor, E. O.:
A long-term survey unveils strong seasonal patterns in the airborne
microbiome coupled to general and regional atmospheric circulations, P.
Natl. Acad. Sci., 115, 12229, <a href="https://doi.org/10.1073/pnas.1812826115" target="_blank">https://doi.org/10.1073/pnas.1812826115</a>, 2018.
</mixed-citation></ref-html>
<ref-html id="bib1.bib13"><label>13</label><mixed-citation>
Cao, C., Jiang, W., Wang, B., Fang, J., Lang, J., Tian, G., Jiang, J., and
Zhu, T. F.: Inhalable microorganisms in Beijing's PM<sub>2.5</sub> and PM<sub>10</sub>
pollutants during a severe smog event, Environ. Sci. Technol., 48,
1499–1507, <a href="https://doi.org/10.1021/es4048472" target="_blank">https://doi.org/10.1021/es4048472</a>, 2014.
</mixed-citation></ref-html>
<ref-html id="bib1.bib14"><label>14</label><mixed-citation>
Cavalli, F., Viana, M., Yttri, K. E., Genberg, J., and Putaud, J.-P.: Toward a standardised thermal-optical protocol for measuring atmospheric organic and elemental carbon: the EUSAAR protocol, Atmos. Meas. Tech., 3, 79–89, <a href="https://doi.org/10.5194/amt-3-79-2010" target="_blank">https://doi.org/10.5194/amt-3-79-2010</a>, 2010.
</mixed-citation></ref-html>
<ref-html id="bib1.bib15"><label>15</label><mixed-citation>
China, S., Burrows, S. M., Wang, B., Harder, T. H., Weis, J., Tanarhte, M.,
Rizzo, L. V., Brito, J., Cirino, G. G., Ma, P.-L., Cliff, J., Artaxo, P.,
Gilles, M. K., and Laskin, A.: Fungal spores as a source of sodium salt
particles in the Amazon basin, Nat. Commun., 9, 4793,
<a href="https://doi.org/10.1038/s41467-018-07066-4" target="_blank">https://doi.org/10.1038/s41467-018-07066-4</a>, 2018.
</mixed-citation></ref-html>
<ref-html id="bib1.bib16"><label>16</label><mixed-citation>
Ciarelli, G., Aksoyoglu, S., Crippa, M., Jimenez, J.-L., Nemitz, E., Sellegri, K., Äijälä, M., Carbone, S., Mohr, C., O'Dowd, C., Poulain, L., Baltensperger, U., and Prévôt, A. S. H.: Evaluation of European air quality modelled by CAMx including the volatility basis set scheme, Atmos. Chem. Phys., 16, 10313–10332, <a href="https://doi.org/10.5194/acp-16-10313-2016" target="_blank">https://doi.org/10.5194/acp-16-10313-2016</a>, 2016.
</mixed-citation></ref-html>
<ref-html id="bib1.bib17"><label>17</label><mixed-citation>
Coz, E., Artíñano, B., Clark, L. M., Hernandez, M., Robinson, A.
L., Casuccio, G. S., Lersch, T. L., and Pandis, S. N.: Characterization of
fine primary biogenic organic aerosol in an urban area in the northeastern
United States, Atmos. Environ., 44, 3952–3962,
<a href="https://doi.org/10.1016/j.atmosenv.2010.07.007" target="_blank">https://doi.org/10.1016/j.atmosenv.2010.07.007</a>, 2010.
</mixed-citation></ref-html>
<ref-html id="bib1.bib18"><label>18</label><mixed-citation>
Dommergue, A., Amato, P., Tignat-Perrier, R., Magand, O., Thollot, A., Joly,
M., Bouvier, L., Sellegri, K., Vogel, T., Sonke, J. E., Jaffrezo, J.-L.,
Andrade, M., Moreno, I., Labuschagne, C., Martin, L., Zhang, Q., and Larose,
C.: Methods to investigate the global atmospheric microbiome, Front.
Microbiol., 10, 243, <a href="https://doi.org/10.3389/fmicb.2019.00243" target="_blank">https://doi.org/10.3389/fmicb.2019.00243</a>, 2019.
</mixed-citation></ref-html>
<ref-html id="bib1.bib19"><label>19</label><mixed-citation>
Elbert, W., Taylor, P. E., Andreae, M. O., and Pöschl, U.: Contribution of fungi to primary biogenic aerosols in the atmosphere: wet and dry discharged spores, carbohydrates, and inorganic ions, Atmos. Chem. Phys., 7, 4569–4588, <a href="https://doi.org/10.5194/acp-7-4569-2007" target="_blank">https://doi.org/10.5194/acp-7-4569-2007</a>, 2007.
</mixed-citation></ref-html>
<ref-html id="bib1.bib20"><label>20</label><mixed-citation>
Ficetola, G., Coissac, E., Zundel, S., Riaz, T., Shehzad, W., Bessière,
J., Taberlet, P., and Pompanon, F.: An in silico approach for the evaluation
of DNA barcodes, BMC Genomics, 11, 434, <a href="https://doi.org/10.1186/1471-2164-11-434" target="_blank">https://doi.org/10.1186/1471-2164-11-434</a>,
2010.
</mixed-citation></ref-html>
<ref-html id="bib1.bib21"><label>21</label><mixed-citation>
Fröhlich-Nowoisky, J., Kampf, C. J., Weber, B., Huffman, J. A.,
Pöhlker, C., Andreae, M. O., Lang-Yona, N., Burrows, S. M., Gunthe, S.
S., Elbert, W., Su, H., Hoor, P., Thines, E., Hoffmann, T., Després, V.
R., and Pöschl, U.: Bioaerosols in the earth system: climate, health,
and ecosystem interactions, Atmos. Res., 182, 346–376,
<a href="https://doi.org/10.1016/j.atmosres.2016.07.018" target="_blank">https://doi.org/10.1016/j.atmosres.2016.07.018</a>, 2016.
</mixed-citation></ref-html>
<ref-html id="bib1.bib22"><label>22</label><mixed-citation>Fu, P., Kawamura, K., Kobayashi, M., and Simoneit, B. R.: Seasonal
variations of sugars in atmospheric particulate matter from Gosan, Jeju
Island: Significant contributions of airborne pollen and Asian dust in
spring, Atmos. Environ., 55, 234–239, <a href="https://doi.org/10.1029/2003JD003697" target="_blank">https://doi.org/10.1029/2003JD003697</a>, 2012.
</mixed-citation></ref-html>
<ref-html id="bib1.bib23"><label>23</label><mixed-citation>
Fuzzi, S., Andreae, M. O., Huebert, B. J., Kulmala, M., Bond, T. C., Boy, M., Doherty, S. J., Guenther, A., Kanakidou, M., Kawamura, K., Kerminen, V.-M., Lohmann, U., Russell, L. M., and Pöschl, U.: Critical assessment of the current state of scientific knowledge, terminology, and research needs concerning the role of organic aerosols in the atmosphere, climate, and global change, Atmos. Chem. Phys., 6, 2017–2038, <a href="https://doi.org/10.5194/acp-6-2017-2006" target="_blank">https://doi.org/10.5194/acp-6-2017-2006</a>, 2006.
</mixed-citation></ref-html>
<ref-html id="bib1.bib24"><label>24</label><mixed-citation>
Fuzzi, S., Baltensperger, U., Carslaw, K., Decesari, S., Denier van der Gon, H., Facchini, M. C., Fowler, D., Koren, I., Langford, B., Lohmann, U., Nemitz, E., Pandis, S., Riipinen, I., Rudich, Y., Schaap, M., Slowik, J. G., Spracklen, D. V., Vignati, E., Wild, M., Williams, M., and Gilardoni, S.: Particulate matter, air quality and climate: lessons learned and future needs, Atmos. Chem. Phys., 15, 8217–8299, <a href="https://doi.org/10.5194/acp-15-8217-2015" target="_blank">https://doi.org/10.5194/acp-15-8217-2015</a>, 2015.
</mixed-citation></ref-html>
<ref-html id="bib1.bib25"><label>25</label><mixed-citation>
Gaston, C. J., Pratt, K. A., Qin, X., and Prather, K. A.: Real-time
detection and mixing state of methanesulfonate in single particles at an
inland urban location during a phytoplankton bloom, Environ. Sci. Technol.,
44, 1566–1572, <a href="https://doi.org/10.1021/es902069d" target="_blank">https://doi.org/10.1021/es902069d</a>, 2010.
</mixed-citation></ref-html>
<ref-html id="bib1.bib26"><label>26</label><mixed-citation>
Golly, B., Waked, A., Weber, S., Samaké, A., Jacob, V., Conil, S.,
Rangognio, J., Chrétien, E., Vagnot, M.-P., Robic, P.-Y., Besombes,
J.-L., and Jaffrezo, J.-L.: Organic markers and OC source apportionment for
seasonal variations of PM<sub>2.5</sub> at 5 rural sites in France, Atmos.
Environ., 198, 142–157, <a href="https://doi.org/10.1016/j.atmosenv.2018.10.027" target="_blank">https://doi.org/10.1016/j.atmosenv.2018.10.027</a>, 2018.
</mixed-citation></ref-html>
<ref-html id="bib1.bib27"><label>27</label><mixed-citation>
Gosselin, M. I., Rathnayake, C. M., Crawford, I., Pöhlker, C., Fröhlich-Nowoisky, J., Schmer, B., Després, V. R., Engling, G., Gallagher, M., Stone, E., Pöschl, U., and Huffman, J. A.: Fluorescent bioaerosol particle, molecular tracer, and fungal spore concentrations during dry and rainy periods in a semi-arid forest, Atmos. Chem. Phys., 16, 15165–15184, <a href="https://doi.org/10.5194/acp-16-15165-2016" target="_blank">https://doi.org/10.5194/acp-16-15165-2016</a>, 2016.
</mixed-citation></ref-html>
<ref-html id="bib1.bib28"><label>28</label><mixed-citation>
Heald, C. L., Coe, H., Jimenez, J. L., Weber, R. J., Bahreini, R., Middlebrook, A. M., Russell, L. M., Jolleys, M., Fu, T.-M., Allan, J. D., Bower, K. N., Capes, G., Crosier, J., Morgan, W. T., Robinson, N. H., Williams, P. I., Cubison, M. J., DeCarlo, P. F., and Dunlea, E. J.: Exploring the vertical profile of atmospheric organic aerosol: comparing 17 aircraft field campaigns with a global model, Atmos. Chem. Phys., 11, 12673–12696, <a href="https://doi.org/10.5194/acp-11-12673-2011" target="_blank">https://doi.org/10.5194/acp-11-12673-2011</a>, 2011.
</mixed-citation></ref-html>
<ref-html id="bib1.bib29"><label>29</label><mixed-citation>
Hill, T. C. J., DeMott, P. J., Conen, F., and Möhler, O.: Impacts of
bioaerosols on atmospheric ice nucleation Processes, in Microbiology of
Aerosols, pp. 195–219, John Wiley &amp; Sons, Ltd.,
<a href="https://doi.org/10.1002/9781119132318" target="_blank">https://doi.org/10.1002/9781119132318</a>, 2017.
</mixed-citation></ref-html>
<ref-html id="bib1.bib30"><label>30</label><mixed-citation>
Hiranuma, N., Adachi, K., Bell, D. M., Belosi, F., Beydoun, H., Bhaduri, B., Bingemer, H., Budke, C., Clemen, H.-C., Conen, F., Cory, K. M., Curtius, J., DeMott, P. J., Eppers, O., Grawe, S., Hartmann, S., Hoffmann, N., Höhler, K., Jantsch, E., Kiselev, A., Koop, T., Kulkarni, G., Mayer, A., Murakami, M., Murray, B. J., Nicosia, A., Petters, M. D., Piazza, M., Polen, M., Reicher, N., Rudich, Y., Saito, A., Santachiara, G., Schiebel, T., Schill, G. P., Schneider, J., Segev, L., Stopelli, E., Sullivan, R. C., Suski, K., Szakáll, M., Tajiri, T., Taylor, H., Tobo, Y., Ullrich, R., Weber, D., Wex, H., Whale, T. F., Whiteside, C. L., Yamashita, K., Zelenyuk, A., and Möhler, O.: A comprehensive characterization of ice nucleation by three different types of cellulose particles immersed in water, Atmos. Chem. Phys., 19, 4823–4849, <a href="https://doi.org/10.5194/acp-19-4823-2019" target="_blank">https://doi.org/10.5194/acp-19-4823-2019</a>, 2019.
</mixed-citation></ref-html>
<ref-html id="bib1.bib31"><label>31</label><mixed-citation>
Hrynkiewicz, K., Baum, C., and Leinweber, P.: Density, metabolic activity,
and identity of cultivable rhizosphere bacteria on Salix viminalis in
disturbed arable and landfill soils, J. Plant Nutr. Soil Sci., 173,
747–756, <a href="https://doi.org/10.1002/jpln.200900286" target="_blank">https://doi.org/10.1002/jpln.200900286</a>, 2010.
</mixed-citation></ref-html>
<ref-html id="bib1.bib32"><label>32</label><mixed-citation>
Hsieh, T. C., Ma, K. H., and Chao, A.: iNEXT: an R package for rarefaction
and extrapolation of species diversity (Hill numbers), Methods Ecol. Evol.,
7, 1451–1456, <a href="https://doi.org/10.1111/2041-210X.12613" target="_blank">https://doi.org/10.1111/2041-210X.12613</a>, 2016.
</mixed-citation></ref-html>
<ref-html id="bib1.bib33"><label>33</label><mixed-citation>
Huerta-Cepas, J., Serra, F., and Bork, P.: ETE 3: Reconstruction, analysis,
and visualization of Phylogenomic Data, Mol. Biol. Evol., 33, 1635–1638,
<a href="https://doi.org/10.1093/molbev/msw046" target="_blank">https://doi.org/10.1093/molbev/msw046</a>, 2016.
</mixed-citation></ref-html>
<ref-html id="bib1.bib34"><label>34</label><mixed-citation>
Huffman, J. A. and Santarpia, J.: Online techniques for quantification and
characterization of biological aerosols, in Microbiology of Aerosols, pp.
83–114, John Wiley &amp; Sons, Ltd., <a href="https://doi.org/10.1002/9781119132318" target="_blank">https://doi.org/10.1002/9781119132318</a>,
2017.
</mixed-citation></ref-html>
<ref-html id="bib1.bib35"><label>35</label><mixed-citation>Huffman, J. A., Perring, A. E., Savage, N. J., Clot, B., Crouzy, B., Tummon,
F., Shoshanim, O., Damit, B., Schneider, J., Sivaprakasam, V., Zawadowicz,
M. A., Crawford, I., Gallagher, M., Topping, D., Doughty, D. C., Hill, S.
C., and Pan, Y.: Real-time sensing of bioaerosols: review and current
perspectives, Aerosol Sci. Technol., 54, 465–495,
<a href="https://doi.org/10.1080/02786826.2019.1664724" target="_blank">https://doi.org/10.1080/02786826.2019.1664724</a>, 2019.
</mixed-citation></ref-html>
<ref-html id="bib1.bib36"><label>36</label><mixed-citation>Itävaara, M., Salavirta, H., Marjamaa, K., and Ruskeeniemi, T.:
Geomicrobiology and metagenomics of Terrestrial Deep Subsurface Microbiomes,
Adv. Appl. Microbiol., 94, 1–77,
<a href="https://doi.org/10.1016/bs.aambs.2015.12.001" target="_blank">https://doi.org/10.1016/bs.aambs.2015.12.001</a>, 2016.
</mixed-citation></ref-html>
<ref-html id="bib1.bib37"><label>37</label><mixed-citation>James, T. Y., Kauff, F., Schoch, C. L., Matheny, P. B., Hofstetter, V., Cox,
C. J., Celio, G., Gueidan, C., Fraker, E., Miadlikowska, J., Lumbsch, H. T.,
Rauhut, A., Reeb, V., Arnold, A. E., Amtoft, A., Stajich, J. E., Hosaka, K.,
Sung, G.-H., Johnson, D., O'Rourke, B., Crockett, M., Binder, M., Curtis, J.
M., Slot, J. C., Wang, Z., Wilson, A. W., Schüßler, A., Longcore, J.
E., O'Donnell, K., Mozley-Standridge, S., Porter, D., Letcher, P. M.,
Powell, M. J., Taylor, J. W., White, M. M., Griffith, G. W., Davies, D. R.,
Humber, R. A., Morton, J. B., Sugiyama, J., Rossman, A. Y., Rogers, J. D.,
Pfister, D. H., Hewitt, D., Hansen, K., Hambleton, S., Shoemaker, R. A.,
Kohlmeyer, J., Volkmann-Kohlmeyer, B., Spotts, R. A., Serdani, M., Crous, P.
W., Hughes, K. W., Matsuura, K., Langer, E., Langer, G., Untereiner, W. A.,
Lücking, R., Büdel, B., Geiser, D. M., Aptroot, A., Diederich, P.,
Schmitt, I., Schultz, M., Yahr, R., Hibbett, D. S., Lutzoni, F., McLaughlin,
D. J., Spatafora, J. W., and Vilgalys, R.: Reconstructing the early
evolution of Fungi using a six-gene phylogeny, Nature, 443, 818–822,
<a href="https://doi.org/10.1038/nature05110" target="_blank">https://doi.org/10.1038/nature05110</a>, 2006.
</mixed-citation></ref-html>
<ref-html id="bib1.bib38"><label>38</label><mixed-citation>
Jia, Y., Bhat, S., and Fraser, M. P.: Characterization of saccharides and
other organic compounds in fine particles and the use of saccharides to
track primary biologically derived carbon sources, Atmos. Environ., 44,
724–732, <a href="https://doi.org/10.1016/j.atmosenv.2009.10.034" target="_blank">https://doi.org/10.1016/j.atmosenv.2009.10.034</a>, 2010a.
</mixed-citation></ref-html>
<ref-html id="bib1.bib39"><label>39</label><mixed-citation>
Jia, Y., Clements, A. L., and Fraser, M. P.: Saccharide composition in
atmospheric particulate matter in the southwest US and estimates of source
contributions, J. Aerosol Sci., 41, 62–73,
<a href="https://doi.org/10.1016/j.jaerosci.2009.08.005" target="_blank">https://doi.org/10.1016/j.jaerosci.2009.08.005</a>, 2010b.
</mixed-citation></ref-html>
<ref-html id="bib1.bib40"><label>40</label><mixed-citation>
Jiang, W., Liang, P., Wang, B., Fang, J., Lang, J., Tian, G., Jiang, J., and
Zhu, T. F.: Optimized DNA extraction and metagenomic sequencing of airborne
microbial communities, Nat. Protoc., 10, 768–779,
<a href="https://doi.org/10.1038/nprot.2015.046" target="_blank">https://doi.org/10.1038/nprot.2015.046</a>, 2015.
</mixed-citation></ref-html>
<ref-html id="bib1.bib41"><label>41</label><mixed-citation>
Jocteur Monrozier, L., Guez, P., Chalamet, A., Bardin, R., Martins, J., and
Gaudet, J. P.: Distribution of microorganisms and fate of xenobiotic
molecules in unsaturated soil environments, Sci. Total Environ., 136,
121–133, <a href="https://doi.org/10.1016/0048-9697(93)90302-M" target="_blank">https://doi.org/10.1016/0048-9697(93)90302-M</a>, 1993.
</mixed-citation></ref-html>
<ref-html id="bib1.bib42"><label>42</label><mixed-citation>
Kang, M., Ren, L., Ren, H., Zhao, Y., Kawamura, K., Zhang, H., Wei, L., Sun,
Y., Wang, Z., and Fu, P.: Primary biogenic and anthropogenic sources of
organic aerosols in Beijing, China: insights from saccharides and n-alkanes,
Environ. Pollut., 243, 1579–1587, <a href="https://doi.org/10.1016/j.envpol.2018.09.118" target="_blank">https://doi.org/10.1016/j.envpol.2018.09.118</a>, 2018.
</mixed-citation></ref-html>
<ref-html id="bib1.bib43"><label>43</label><mixed-citation>
Kelly, F. J. and Fussell, J. C.: Air pollution and public health: emerging
hazards and improved understanding of risk, Environ. Geochem. Health, 37,
631–649, <a href="https://doi.org/10.1007/s10653-015-9720-1" target="_blank">https://doi.org/10.1007/s10653-015-9720-1</a>, 2015.
</mixed-citation></ref-html>
<ref-html id="bib1.bib44"><label>44</label><mixed-citation>
Kuffner, M., De Maria, S., Puschenreiter, M., Fallmann, K., Wieshammer, G.,
Gorfer, M., Strauss, J., Rivelli, A. R., and Sessitsch, A.: Culturable
bacteria from Zn- and Cd-accumulating Salix caprea with differential effects
on plant growth and heavy metal availability, J. Appl. Microbiol., 108,
1471–1484, <a href="https://doi.org/10.1111/j.1365-2672.2010.04670.x" target="_blank">https://doi.org/10.1111/j.1365-2672.2010.04670.x</a>, 2010.
</mixed-citation></ref-html>
<ref-html id="bib1.bib45"><label>45</label><mixed-citation>
Liu, H., Hu, Z., Zhou, M., Hu, J., Yao, X., Zhang, H., Li, Z., Lou, L., Xi,
C., Qian, H., Li, C., Xu, X., Zheng, P., and Hu, B.: The distribution
variance of airborne microorganisms in urban and rural environments,
Environ. Pollut., 247, 898–906, <a href="https://doi.org/10.1016/j.envpol.2019.01.090" target="_blank">https://doi.org/10.1016/j.envpol.2019.01.090</a>, 2019.
</mixed-citation></ref-html>
<ref-html id="bib1.bib46"><label>46</label><mixed-citation>
Luhung, I., Wu, Y., Ng, C. K., Miller, D., Cao, B., and Chang, V. W.-C.:
Protocol improvements for low concentration DNA-based bioaerosol sampling
and analysis, PLOS ONE, 10, e0141158, <a href="https://doi.org/10.1371/journal.pone.0141158" target="_blank">https://doi.org/10.1371/journal.pone.0141158</a>,
2015.
</mixed-citation></ref-html>
<ref-html id="bib1.bib47"><label>47</label><mixed-citation>
Lymperopoulou, D. S., Adams, R. I., and Lindow, S. E.: Contribution of
vegetation to the microbial composition of nearby outdoor air, Appl.
Environ. Microbiol., 82, 3822–3833, <a href="https://doi.org/10.1128/AEM.00610-16" target="_blank">https://doi.org/10.1128/AEM.00610-16</a>, 2016.
</mixed-citation></ref-html>
<ref-html id="bib1.bib48"><label>48</label><mixed-citation>
Maron, P.-A., Lejon, D. P. H., Carvalho, E., Bizet, K., Lemanceau, P.,
Ranjard, L., and Mougel, C.: Assessing genetic structure and diversity of
airborne bacterial communities by DNA fingerprinting and 16S rDNA clone
library, Atmos. Environ., 39, 3687–3695,
<a href="https://doi.org/10.1016/j.atmosenv.2005.03.002" target="_blank">https://doi.org/10.1016/j.atmosenv.2005.03.002</a>, 2005.
</mixed-citation></ref-html>
<ref-html id="bib1.bib49"><label>49</label><mixed-citation>
McMurdie, P. J. and Holmes, S.: phyloseq: An R package for reproducible
interactive analysis and graphics of microbiome sensus Data, PLoS ONE, 8,
e61217, <a href="https://doi.org/10.1371/journal.pone.0061217" target="_blank">https://doi.org/10.1371/journal.pone.0061217</a>, 2013.
</mixed-citation></ref-html>
<ref-html id="bib1.bib50"><label>50</label><mixed-citation>
Medeiros, P. M., Conte, M. H., Weber, J. C., and Simoneit, B. R. T.: Sugars
as source indicators of biogenic organic carbon in aerosols collected above
the howland experimental forest, Maine, Atmos. Environ., 40, 1694–1705,
<a href="https://doi.org/10.1016/j.atmosenv.2005.11.001" target="_blank">https://doi.org/10.1016/j.atmosenv.2005.11.001</a>, 2006.
 </mixed-citation></ref-html>
<ref-html id="bib1.bib51"><label>51</label><mixed-citation>
Mercier, C., Boyer, F., Kopylova, E., Taberlet, P., Bonin, A., and Coissac,
E.: SUMATRA and SUMACLUST: fast and exact comparison and clustering of
sequences. Programs and Abstracts of the SeqBio, Workshop, pp. 27–29,
2013.
</mixed-citation></ref-html>
<ref-html id="bib1.bib52"><label>52</label><mixed-citation>
Mhuireach, G., Johnson, B. R., Altrichter, A. E., Ladau, J., Meadow, J. F.,
Pollard, K. S., and Green, J. L.: Urban greenness influences airborne
bacterial community composition, Sci. Total Environ., 571, 680–687,
<a href="https://doi.org/10.1016/j.scitotenv.2016.07.037" target="_blank">https://doi.org/10.1016/j.scitotenv.2016.07.037</a>, 2016.
</mixed-citation></ref-html>
<ref-html id="bib1.bib53"><label>53</label><mixed-citation>
Moore, D., Robson, G. D., and Trinci, A. P. J.: 21st century guidebook to
fungi, Cambridge University Press, Cambridge,
<a href="https://doi.org/10.1017/CBO9780511977022" target="_blank">https://doi.org/10.1017/CBO9780511977022</a>, 2011.
</mixed-citation></ref-html>
<ref-html id="bib1.bib54"><label>54</label><mixed-citation>
Ng, T. W., Ip, M., Chao, C. Y. H., Tang, J. W., Lai, K. P., Fu, S. C.,
Leung, W. T., and Lai, K. M.: Differential gene expression in Escherichia
coli during aerosolization from liquid suspension, Appl. Microbiol.
Biotechnol., 102, 6257–6267, <a href="https://doi.org/10.1007/s00253-018-9083-5" target="_blank">https://doi.org/10.1007/s00253-018-9083-5</a>, 2018.
</mixed-citation></ref-html>
<ref-html id="bib1.bib55"><label>55</label><mixed-citation>
Ofek, M., Hadar, Y., and Minz, D.: Ecology of root colonizing massilia
(oxalobacteraceae), PLoS ONE, 7, e40117,
<a href="https://doi.org/10.1371/journal.pone.0040117" target="_blank">https://doi.org/10.1371/journal.pone.0040117</a>, 2012.
</mixed-citation></ref-html>
<ref-html id="bib1.bib56"><label>56</label><mixed-citation>
Oksanen, J., Blanchet, F. G., Friendly, M., Kindt, R., Legendre, P.,
McGlinn, D., R. Minchin, P. R., O'Hara, R. B., Simpson, G. L., Solymos,
Peter, Stevens, M. H. H., Szoecs, E., and Wagner, H.: Vegan: community
ecology package, available at: <a href="https://cran.r-project.org" target="_blank"/> (last access: 7 May 2020) and
<a href="https://github.com/vegandevs/vegan" target="_blank"/> (last access: 7 May 2020), 2019.
</mixed-citation></ref-html>
<ref-html id="bib1.bib57"><label>57</label><mixed-citation>
Oliveira, M., Ribeiro, H., Delgado, J. L., and Abreu, I.: The effects of
meteorological factors on airborne fungal spore concentration in two areas
differing in urbanisation level, Int. J. Biometeorol., 53, 61–73,
<a href="https://doi.org/10.1007/s00484-008-0191-2" target="_blank">https://doi.org/10.1007/s00484-008-0191-2</a>, 2009.
</mixed-citation></ref-html>
<ref-html id="bib1.bib58"><label>58</label><mixed-citation>
Prather, K. A., Bertram, T. H., Grassian, V. H., Deane, G. B., Stokes, M.
D., DeMott, P. J., Aluwihare, L. I., Palenik, B. P., Azam, F., Seinfeld, J.
H., Moffet, R. C., Molina, M. J., Cappa, C. D., Geiger, F. M., Roberts, G.
C., Russell, L. M., Ault, A. P., Baltrusaitis, J., Collins, D. B., Corrigan,
C. E., Cuadra-Rodriguez, L. A., Ebben, C. J., Forestieri, S. D., Guasco, T.
L., Hersey, S. P., Kim, M. J., Lambert, W. F., Modini, R. L., Mui, W.,
Pedler, B. E., Ruppel, M. J., Ryder, O. S., Schoepp, N. G., Sullivan, R. C.,
and Zhao, D.: Bringing the ocean into the laboratory to probe the chemical
complexity of sea spray aerosol, P. Natl. Acad. Sci. USA, 110,
7550–7555, <a href="https://doi.org/10.1073/pnas.1300262110" target="_blank">https://doi.org/10.1073/pnas.1300262110</a>, 2013.
</mixed-citation></ref-html>
<ref-html id="bib1.bib59"><label>59</label><mixed-citation>
Pietrogrande, M. C., Bacco, D., Visentin, M., Ferrari, S., and Casali, P.:
Polar organic marker compounds in atmospheric aerosol in the Po valley
during the Supersito campaigns – part 2: seasonal variations of sugars,
Atmos. Environ., 97, 215–225, <a href="https://doi.org/10.1016/j.atmosenv.2014.07.056" target="_blank">https://doi.org/10.1016/j.atmosenv.2014.07.056</a>, 2014.
</mixed-citation></ref-html>
<ref-html id="bib1.bib60"><label>60</label><mixed-citation>
Pope, C. A. and Dockery, D. W.: Health effects of fine particulate air
pollution: lines that connect, J. Air Waste Manag. Assoc., 56, 709–742,
2006.
</mixed-citation></ref-html>
<ref-html id="bib1.bib61"><label>61</label><mixed-citation>Rastogi, G., Coaker, G. L., and Leveau, J. H. J.: New insights into the
structure and function of phyllosphere microbiota through high-throughput
molecular approaches, FEMS Microbiol. Lett., 348, 1–10,
<a href="https://doi.org/10.1111/1574-6968.12225" target="_blank">https://doi.org/10.1111/1574-6968.12225</a>, 2013.
</mixed-citation></ref-html>
<ref-html id="bib1.bib62"><label>62</label><mixed-citation>Rathnayake, C. M., Metwali, N., Baker, Z., Jayarathne, T., Kostle, P. A.,
Thorne, P. S., O'Shaughnessy, P. T., and Stone, E. A.: Urban enhancement of
PM<sub>10</sub> bioaerosol tracers relative to background locations in the
midwestern United States, J. Geophys. Res.-Atmos., 121, 5071–5089,
<a href="https://doi.org/10.1002/2015JD024538" target="_blank">https://doi.org/10.1002/2015JD024538</a>, 2016.
</mixed-citation></ref-html>
<ref-html id="bib1.bib63"><label>63</label><mixed-citation>
Samaké, A., Uzu, G., Martins, J. M. F., Calas, A., Vince, E., Parat, S.,
and Jaffrezo, J. L.: The unexpected role of bioaerosols in the Oxidative
Potential of PM, Sci. Rep., 7, 10978, <a href="https://doi.org/10.1038/s41598-017-11178-0" target="_blank">https://doi.org/10.1038/s41598-017-11178-0</a>, 2017.
</mixed-citation></ref-html>
<ref-html id="bib1.bib64"><label>64</label><mixed-citation>
Samaké, A., Jaffrezo, J.-L., Favez, O., Weber, S., Jacob, V., Canete, T., Albinet, A., Charron, A., Riffault, V., Perdrix, E., Waked, A., Golly, B., Salameh, D., Chevrier, F., Oliveira, D. M., Besombes, J.-L., Martins, J. M. F., Bonnaire, N., Conil, S., Guillaud, G., Mesbah, B., Rocq, B., Robic, P.-Y., Hulin, A., Le Meur, S., Descheemaecker, M., Chretien, E., Marchand, N., and Uzu, G.: Arabitol, mannitol, and glucose as tracers of primary biogenic organic aerosol: the influence of environmental factors on ambient air concentrations and spatial distribution over France, Atmos. Chem. Phys., 19, 11013–11030, <a href="https://doi.org/10.5194/acp-19-11013-2019" target="_blank">https://doi.org/10.5194/acp-19-11013-2019</a>, 2019a.
</mixed-citation></ref-html>
<ref-html id="bib1.bib65"><label>65</label><mixed-citation>
Samaké, A., Jaffrezo, J.-L., Favez, O., Weber, S., Jacob, V., Albinet, A., Riffault, V., Perdrix, E., Waked, A., Golly, B., Salameh, D., Chevrier, F., Oliveira, D. M., Bonnaire, N., Besombes, J.-L., Martins, J. M. F., Conil, S., Guillaud, G., Mesbah, B., Rocq, B., Robic, P.-Y., Hulin, A., Le Meur, S., Descheemaecker, M., Chretien, E., Marchand, N., and Uzu, G.: Polyols and glucose particulate species as tracers of primary biogenic organic aerosols at 28 French sites, Atmos. Chem. Phys., 19, 3357–3374, <a href="https://doi.org/10.5194/acp-19-3357-2019" target="_blank">https://doi.org/10.5194/acp-19-3357-2019</a>, 2019b.
</mixed-citation></ref-html>
<ref-html id="bib1.bib66"><label>66</label><mixed-citation>
Samaké, A., Bonin, A., Jaffrezo, J.-L., Taberlet, P., Weber, S., Uzu, G., Jacob, V., Conil, S., and Martins, J. M. F.: Sequencing data from: High levels of primary biogenic organic aerosols are
driven by only a few plant-associated microbial taxa, v2, Dryad, Dataset, <a href="https://doi.org/10.5061/dryad.2fqz612m4" target="_blank">https://doi.org/10.5061/dryad.2fqz612m4</a>, 2020.
</mixed-citation></ref-html>
<ref-html id="bib1.bib67"><label>67</label><mixed-citation>
Schnell, I. B., Bohmann, K., and Gilbert, M. T. P.: Tag jumps illuminated –
reducing sequence-to-sample misidentifications in metabarcoding studies,
Mol. Ecol. Resour., 15, 1289–1303, <a href="https://doi.org/10.1111/1755-0998.12402" target="_blank">https://doi.org/10.1111/1755-0998.12402</a>, 2015.
</mixed-citation></ref-html>
<ref-html id="bib1.bib68"><label>68</label><mixed-citation>
Taberlet, P., Bonin, A., Zinger, L., and Coissac, E.: Environmental DNA: for
biodiversity research and monitoring, Oxford University Press, Oxford, New
York, <a href="https://doi.org/10.1093/oso/9780198767220.001.0001" target="_blank">https://doi.org/10.1093/oso/9780198767220.001.0001</a>, 2018.
</mixed-citation></ref-html>
<ref-html id="bib1.bib69"><label>69</label><mixed-citation>
Verma, S. K., Kawamura, K., Chen, J., and Fu, P.: Thirteen years of observations on primary sugars and sugar alcohols over remote Chichijima Island in the western North Pacific, Atmos. Chem. Phys., 18, 81–101, <a href="https://doi.org/10.5194/acp-18-81-2018" target="_blank">https://doi.org/10.5194/acp-18-81-2018</a>, 2018.
</mixed-citation></ref-html>
<ref-html id="bib1.bib70"><label>70</label><mixed-citation>
Waked, A., Favez, O., Alleman, L. Y., Piot, C., Petit, J.-E., Delaunay, T., Verlinden, E., Golly, B., Besombes, J.-L., Jaffrezo, J.-L., and Leoz-Garziandia, E.: Source apportionment of PM<sub>10</sub> in a north-western Europe regional urban background site (Lens, France) using positive matrix factorization and including primary biogenic emissions, Atmos. Chem. Phys., 14, 3325–3346, <a href="https://doi.org/10.5194/acp-14-3325-2014" target="_blank">https://doi.org/10.5194/acp-14-3325-2014</a>, 2014.
</mixed-citation></ref-html>
<ref-html id="bib1.bib71"><label>71</label><mixed-citation>
Weber, S., Uzu, G., Calas, A., Chevrier, F., Besombes, J.-L., Charron, A., Salameh, D., Ježek, I., Močnik, G., and Jaffrezo, J.-L.: An apportionment method for the oxidative potential of atmospheric particulate matter sources: application to a one-year study in Chamonix, France, Atmos. Chem. Phys., 18, 9617–9629, <a href="https://doi.org/10.5194/acp-18-9617-2018" target="_blank">https://doi.org/10.5194/acp-18-9617-2018</a>, 2018.
</mixed-citation></ref-html>
<ref-html id="bib1.bib72"><label>72</label><mixed-citation>
Wei, M., Xu, C., Xu, X., Zhu, C., Li, J., and Lv, G.: Characteristics of
atmospheric bacterial and fungal communities in PM<sub>2.5</sub> following biomass
burning disturbance in a rural area of North China Plain, Sci. Total
Environ., 651, 2727–2739, <a href="https://doi.org/10.1016/j.scitotenv.2018.09.399" target="_blank">https://doi.org/10.1016/j.scitotenv.2018.09.399</a>, 2019a.
</mixed-citation></ref-html>
<ref-html id="bib1.bib73"><label>73</label><mixed-citation>
Wei, M., Xu, C., Xu, X., Zhu, C., Li, J., and Lv, G.: Size distribution of
bioaerosols from biomass burning emissions: characteristics of bacterial and
fungal communities in submicron (PM<sub>1.0</sub>) and fine (PM<sub>2.5</sub>)
particles, Ecotoxicol. Environ. Saf., 171, 37–46,
<a href="https://doi.org/10.1016/j.ecoenv.2018.12.026" target="_blank">https://doi.org/10.1016/j.ecoenv.2018.12.026</a>, 2019b.
</mixed-citation></ref-html>
<ref-html id="bib1.bib74"><label>74</label><mixed-citation>
Weinert, N., Meincke, R., Gottwald, C., Radl, V., Dong, X., Schloter, M.,
Berg, G., and Smalla, K.: Effects of genetically modified potatoes with
increased zeaxanthin content on the abundance and diversity of rhizobacteria
with in vitro antagonistic activity do not exceed natural variability among
cultivars, Plant Soil, 326, 437–452, <a href="https://doi.org/10.1007/s11104-009-0024-z" target="_blank">https://doi.org/10.1007/s11104-009-0024-z</a>,
2010.
</mixed-citation></ref-html>
<ref-html id="bib1.bib75"><label>75</label><mixed-citation>
Welsh, D. T.: Ecological significance of compatible solute accumulation by
micro-organisms: from single cells to global climate, FEMS Microbiol. Rev.,
24, 263–290, <a href="https://doi.org/10.1111/j.1574-6976.2000.tb00542.x" target="_blank">https://doi.org/10.1111/j.1574-6976.2000.tb00542.x</a>, 2000.
</mixed-citation></ref-html>
<ref-html id="bib1.bib76"><label>76</label><mixed-citation>
Womack, A. M., Artaxo, P. E., Ishida, F. Y., Mueller, R. C., Saleska, S. R., Wiedemann, K. T., Bohannan, B. J. M., and Green, J. L.: Characterization of active and total fungal communities in the atmosphere over the Amazon rainforest, Biogeosciences, 12, 6337–6349, <a href="https://doi.org/10.5194/bg-12-6337-2015" target="_blank">https://doi.org/10.5194/bg-12-6337-2015</a>, 2015.
</mixed-citation></ref-html>
<ref-html id="bib1.bib77"><label>77</label><mixed-citation>
Xu, C., Wei, M., Chen, J., Zhu, C., Li, J., Lv, G., Xu, X., Zheng, L., Sui, G., Li, W., Chen, B., Wang, W., Zhang, Q., Ding, A., and Mellouki, A.: Fungi diversity in PM<sub>2.5</sub> and PM<sub>1</sub> at the summit of Mt. Tai: abundance, size distribution, and seasonal variation, Atmos. Chem. Phys., 17, 11247–11260, <a href="https://doi.org/10.5194/acp-17-11247-2017" target="_blank">https://doi.org/10.5194/acp-17-11247-2017</a>, 2017.
</mixed-citation></ref-html>
<ref-html id="bib1.bib78"><label>78</label><mixed-citation>
Xue, C., Liu, T., Chen, L., Li, W., Liu, I., Kronstad, J. W., Seyfang, A.
and Heitman, J.: Role of an expanded inositol transporter repertoire in
cryptococcus neoformans sexual reproduction and virulence, 1, e00084-10,
<a href="https://doi.org/10.1128/mBio.00084-10" target="_blank">https://doi.org/10.1128/mBio.00084-10</a>, 2010.
</mixed-citation></ref-html>
<ref-html id="bib1.bib79"><label>79</label><mixed-citation>
Yadav, A. N., Verma, P., Sachan, S. G., Kaushik, R., and Saxena, A. K.:
Psychrotrophic microbiomes: molecular diversity and beneficial role in plant
growth promotion and soil health, in Microorganisms for Green Revolution,
vol. 7, pp. 197–240, Springer Singapore, Singapore, <a href="https://doi.org/10.1007/978-981-10-7146-1_11" target="_blank">https://doi.org/10.1007/978-981-10-7146-1_11</a>, 2018.
</mixed-citation></ref-html>
<ref-html id="bib1.bib80"><label>80</label><mixed-citation>
Yan, C., Sullivan, A. P., Cheng, Y., Zheng, M., Zhang, Y., Zhu, T., and
Collett, J. L.: Characterization of saccharides and associated usage in
determining biogenic and biomass burning aerosols in atmospheric fine
particulate matter in the North China Plain, Sci. Total Environ., 650,
2939–2950, <a href="https://doi.org/10.1016/j.scitotenv.2018.09.325" target="_blank">https://doi.org/10.1016/j.scitotenv.2018.09.325</a>, 2019.
</mixed-citation></ref-html>
<ref-html id="bib1.bib81"><label>81</label><mixed-citation>
Yang, Y., Chan, C., Tao, J., Lin, M., Engling, G., Zhang, Z., Zhang, T., and
Su, L.: Observation of elevated fungal tracers due to biomass burning in the
Sichuan Basin at Chengdu City, China, Sci. Total Environ., 431, 68–77,
2012.
</mixed-citation></ref-html>
<ref-html id="bib1.bib82"><label>82</label><mixed-citation>
Yu, X., Wang, Z., Zhang, M., Kuhn, U., Xie, Z., Cheng, Y., Pöschl, U., and Su, H.: Ambient measurement of fluorescent aerosol particles with a WIBS in the Yangtze River Delta of China: potential impacts of combustion-related aerosol particles, Atmos. Chem. Phys., 16, 11337–11348, <a href="https://doi.org/10.5194/acp-16-11337-2016" target="_blank">https://doi.org/10.5194/acp-16-11337-2016</a>, 2016.

</mixed-citation></ref-html>
<ref-html id="bib1.bib83"><label>83</label><mixed-citation>
Zhu, C., Kawamura, K., and Kunwar, B.: Organic tracers of primary biological
aerosol particles at subtropical Okinawa Island in the western North Pacific
Rim: organic biomarkers in the north pacific, J. Geophys.
Res.-Atmos., 120, 5504–5523, 2015.
</mixed-citation></ref-html>--></article>
